ID: 943191300

View in Genome Browser
Species Human (GRCh38)
Location 2:184682048-184682070
Sequence CTTTGGGCACCAACAAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191290_943191300 3 Left 943191290 2:184682022-184682044 CCCTGCCGCCTCAGCCCCCTCTG No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data
943191291_943191300 2 Left 943191291 2:184682023-184682045 CCTGCCGCCTCAGCCCCCTCTGA No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data
943191288_943191300 5 Left 943191288 2:184682020-184682042 CCCCCTGCCGCCTCAGCCCCCTC No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data
943191289_943191300 4 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data
943191293_943191300 -5 Left 943191293 2:184682030-184682052 CCTCAGCCCCCTCTGAAACTTTG No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data
943191292_943191300 -2 Left 943191292 2:184682027-184682049 CCGCCTCAGCCCCCTCTGAAACT No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191300 Original CRISPR CTTTGGGCACCAACAAGCTT AGG Intronic
No off target data available for this crispr