ID: 943191302

View in Genome Browser
Species Human (GRCh38)
Location 2:184682052-184682074
Sequence GGGCACCAACAAGCTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191293_943191302 -1 Left 943191293 2:184682030-184682052 CCTCAGCCCCCTCTGAAACTTTG No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191289_943191302 8 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191291_943191302 6 Left 943191291 2:184682023-184682045 CCTGCCGCCTCAGCCCCCTCTGA No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191290_943191302 7 Left 943191290 2:184682022-184682044 CCCTGCCGCCTCAGCCCCCTCTG No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191288_943191302 9 Left 943191288 2:184682020-184682042 CCCCCTGCCGCCTCAGCCCCCTC No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191298_943191302 -9 Left 943191298 2:184682038-184682060 CCCTCTGAAACTTTGGGCACCAA No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191297_943191302 -8 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191292_943191302 2 Left 943191292 2:184682027-184682049 CCGCCTCAGCCCCCTCTGAAACT No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191299_943191302 -10 Left 943191299 2:184682039-184682061 CCTCTGAAACTTTGGGCACCAAC No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191296_943191302 -7 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191302 Original CRISPR GGGCACCAACAAGCTTAGGG AGG Intronic
No off target data available for this crispr