ID: 943191304

View in Genome Browser
Species Human (GRCh38)
Location 2:184682057-184682079
Sequence GTCTCCCTCCCTAAGCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191304_943191310 21 Left 943191304 2:184682057-184682079 CCAACAAGCTTAGGGAGGGAGAC No data
Right 943191310 2:184682101-184682123 ATGGGCCTGCAGTCAGCTCATGG No data
943191304_943191308 2 Left 943191304 2:184682057-184682079 CCAACAAGCTTAGGGAGGGAGAC No data
Right 943191308 2:184682082-184682104 GTGAGGGCTGAGTCTTCGCATGG No data
943191304_943191309 3 Left 943191304 2:184682057-184682079 CCAACAAGCTTAGGGAGGGAGAC No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191304 Original CRISPR GTCTCCCTCCCTAAGCTTGT TGG (reversed) Intronic