ID: 943191309

View in Genome Browser
Species Human (GRCh38)
Location 2:184682083-184682105
Sequence TGAGGGCTGAGTCTTCGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191297_943191309 23 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191304_943191309 3 Left 943191304 2:184682057-184682079 CCAACAAGCTTAGGGAGGGAGAC No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191293_943191309 30 Left 943191293 2:184682030-184682052 CCTCAGCCCCCTCTGAAACTTTG No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191296_943191309 24 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191298_943191309 22 Left 943191298 2:184682038-184682060 CCCTCTGAAACTTTGGGCACCAA No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191299_943191309 21 Left 943191299 2:184682039-184682061 CCTCTGAAACTTTGGGCACCAAC No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191309 Original CRISPR TGAGGGCTGAGTCTTCGCAT GGG Intronic
No off target data available for this crispr