ID: 943191310

View in Genome Browser
Species Human (GRCh38)
Location 2:184682101-184682123
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191307_943191310 -1 Left 943191307 2:184682079-184682101 CCAGTGAGGGCTGAGTCTTCGCA No data
Right 943191310 2:184682101-184682123 ATGGGCCTGCAGTCAGCTCATGG No data
943191304_943191310 21 Left 943191304 2:184682057-184682079 CCAACAAGCTTAGGGAGGGAGAC No data
Right 943191310 2:184682101-184682123 ATGGGCCTGCAGTCAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type