ID: 943191799

View in Genome Browser
Species Human (GRCh38)
Location 2:184686283-184686305
Sequence TCCAGGGGGCCAGCAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191799_943191809 29 Left 943191799 2:184686283-184686305 CCAGCTCTTGCTGGCCCCCTGGA No data
Right 943191809 2:184686335-184686357 TGCAGCCAACATCTTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191799 Original CRISPR TCCAGGGGGCCAGCAAGAGC TGG (reversed) Intronic
No off target data available for this crispr