ID: 943203566

View in Genome Browser
Species Human (GRCh38)
Location 2:184860880-184860902
Sequence GAGTCTTGGGTCTCTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943203559_943203566 2 Left 943203559 2:184860855-184860877 CCAAGCTCAGTGCTGGCGCATTC No data
Right 943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG No data
943203557_943203566 15 Left 943203557 2:184860842-184860864 CCTGGGGCAATGGCCAAGCTCAG No data
Right 943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG No data
943203556_943203566 22 Left 943203556 2:184860835-184860857 CCTAAAGCCTGGGGCAATGGCCA No data
Right 943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943203566 Original CRISPR GAGTCTTGGGTCTCTGGGGT TGG Intronic
No off target data available for this crispr