ID: 943221276

View in Genome Browser
Species Human (GRCh38)
Location 2:185109596-185109618
Sequence TGGACCCCCTGTTCAATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943221274_943221276 1 Left 943221274 2:185109572-185109594 CCAACAAAAACAAAAAATGGGGA No data
Right 943221276 2:185109596-185109618 TGGACCCCCTGTTCAATAAGTGG No data
943221270_943221276 21 Left 943221270 2:185109552-185109574 CCATCTGATCTTTGATAAGGCCA No data
Right 943221276 2:185109596-185109618 TGGACCCCCTGTTCAATAAGTGG No data
943221268_943221276 28 Left 943221268 2:185109545-185109567 CCTACAACCATCTGATCTTTGAT 0: 31
1: 513
2: 1595
3: 1628
4: 1775
Right 943221276 2:185109596-185109618 TGGACCCCCTGTTCAATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943221276 Original CRISPR TGGACCCCCTGTTCAATAAG TGG Intergenic
No off target data available for this crispr