ID: 943223583

View in Genome Browser
Species Human (GRCh38)
Location 2:185140695-185140717
Sequence CAAAAAGCCGATAGTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943223583_943223586 4 Left 943223583 2:185140695-185140717 CCCACATCACTATCGGCTTTTTG No data
Right 943223586 2:185140722-185140744 AAGCCATTCAACAATTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943223583 Original CRISPR CAAAAAGCCGATAGTGATGT GGG (reversed) Intergenic