ID: 943228169

View in Genome Browser
Species Human (GRCh38)
Location 2:185208444-185208466
Sequence GAGGAATCCTGCTACTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943228169_943228178 4 Left 943228169 2:185208444-185208466 CCCTGTTAGTAGCAGGATTCCTC No data
Right 943228178 2:185208471-185208493 GGGCAGCAGAGGATCATGTAGGG No data
943228169_943228177 3 Left 943228169 2:185208444-185208466 CCCTGTTAGTAGCAGGATTCCTC No data
Right 943228177 2:185208470-185208492 GGGGCAGCAGAGGATCATGTAGG No data
943228169_943228175 -7 Left 943228169 2:185208444-185208466 CCCTGTTAGTAGCAGGATTCCTC No data
Right 943228175 2:185208460-185208482 ATTCCTCATGGGGGCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943228169 Original CRISPR GAGGAATCCTGCTACTAACA GGG (reversed) Intergenic
No off target data available for this crispr