ID: 943228288

View in Genome Browser
Species Human (GRCh38)
Location 2:185209715-185209737
Sequence TTCAATTATTCTTACCGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943228288_943228296 22 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228296 2:185209760-185209782 GGCTGCTTTCACAATGGAGGCGG No data
943228288_943228290 -4 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228290 2:185209734-185209756 TGAACCTGATTATCAGAAGGAGG No data
943228288_943228298 24 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228298 2:185209762-185209784 CTGCTTTCACAATGGAGGCGGGG No data
943228288_943228292 0 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG No data
943228288_943228293 1 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228293 2:185209739-185209761 CTGATTATCAGAAGGAGGAAGGG No data
943228288_943228297 23 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228297 2:185209761-185209783 GCTGCTTTCACAATGGAGGCGGG No data
943228288_943228294 16 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228294 2:185209754-185209776 AGGAAGGGCTGCTTTCACAATGG No data
943228288_943228289 -7 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228289 2:185209731-185209753 AATTGAACCTGATTATCAGAAGG No data
943228288_943228295 19 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228295 2:185209757-185209779 AAGGGCTGCTTTCACAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943228288 Original CRISPR TTCAATTATTCTTACCGATG TGG (reversed) Intergenic
No off target data available for this crispr