ID: 943228292

View in Genome Browser
Species Human (GRCh38)
Location 2:185209738-185209760
Sequence CCTGATTATCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943228288_943228292 0 Left 943228288 2:185209715-185209737 CCACATCGGTAAGAATAATTGAA No data
Right 943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943228292 Original CRISPR CCTGATTATCAGAAGGAGGA AGG Intergenic
No off target data available for this crispr