ID: 943236404

View in Genome Browser
Species Human (GRCh38)
Location 2:185326186-185326208
Sequence ATCTGTAAGGAATAGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943236400_943236404 27 Left 943236400 2:185326136-185326158 CCATTTTATCTTCCTCCATAGCA No data
Right 943236404 2:185326186-185326208 ATCTGTAAGGAATAGATGTGAGG No data
943236402_943236404 12 Left 943236402 2:185326151-185326173 CCATAGCAACAATAGCAACTACA No data
Right 943236404 2:185326186-185326208 ATCTGTAAGGAATAGATGTGAGG No data
943236401_943236404 15 Left 943236401 2:185326148-185326170 CCTCCATAGCAACAATAGCAACT No data
Right 943236404 2:185326186-185326208 ATCTGTAAGGAATAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943236404 Original CRISPR ATCTGTAAGGAATAGATGTG AGG Intergenic
No off target data available for this crispr