ID: 943237336

View in Genome Browser
Species Human (GRCh38)
Location 2:185338844-185338866
Sequence TAGAGAGAGCACAGTGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943237336_943237340 30 Left 943237336 2:185338844-185338866 CCACAGTCACTGTGCTCTCTCTA No data
Right 943237340 2:185338897-185338919 ATGTGGTCACTGCCAGTGGCTGG No data
943237336_943237338 26 Left 943237336 2:185338844-185338866 CCACAGTCACTGTGCTCTCTCTA No data
Right 943237338 2:185338893-185338915 TGCCATGTGGTCACTGCCAGTGG No data
943237336_943237337 13 Left 943237336 2:185338844-185338866 CCACAGTCACTGTGCTCTCTCTA No data
Right 943237337 2:185338880-185338902 GATTCTCTCTCTGTGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943237336 Original CRISPR TAGAGAGAGCACAGTGACTG TGG (reversed) Intergenic
No off target data available for this crispr