ID: 943237337

View in Genome Browser
Species Human (GRCh38)
Location 2:185338880-185338902
Sequence GATTCTCTCTCTGTGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943237335_943237337 14 Left 943237335 2:185338843-185338865 CCCACAGTCACTGTGCTCTCTCT No data
Right 943237337 2:185338880-185338902 GATTCTCTCTCTGTGCCATGTGG No data
943237336_943237337 13 Left 943237336 2:185338844-185338866 CCACAGTCACTGTGCTCTCTCTA No data
Right 943237337 2:185338880-185338902 GATTCTCTCTCTGTGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943237337 Original CRISPR GATTCTCTCTCTGTGCCATG TGG Intergenic
No off target data available for this crispr