ID: 943237340

View in Genome Browser
Species Human (GRCh38)
Location 2:185338897-185338919
Sequence ATGTGGTCACTGCCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943237336_943237340 30 Left 943237336 2:185338844-185338866 CCACAGTCACTGTGCTCTCTCTA No data
Right 943237340 2:185338897-185338919 ATGTGGTCACTGCCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943237340 Original CRISPR ATGTGGTCACTGCCAGTGGC TGG Intergenic
No off target data available for this crispr