ID: 943240350

View in Genome Browser
Species Human (GRCh38)
Location 2:185376731-185376753
Sequence CAGAATCTAGAGAAGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943240342_943240350 27 Left 943240342 2:185376681-185376703 CCCTGACTGGGGCTGCTTCATTT No data
Right 943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG No data
943240344_943240350 4 Left 943240344 2:185376704-185376726 CCTTCAGAGATGCCCTGCCCAGT 0: 29
1: 40
2: 50
3: 97
4: 305
Right 943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG No data
943240343_943240350 26 Left 943240343 2:185376682-185376704 CCTGACTGGGGCTGCTTCATTTC No data
Right 943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG No data
943240347_943240350 -9 Left 943240347 2:185376717-185376739 CCTGCCCAGTGAGGCAGAATCTA No data
Right 943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG No data
943240341_943240350 28 Left 943240341 2:185376680-185376702 CCCCTGACTGGGGCTGCTTCATT No data
Right 943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG No data
943240346_943240350 -8 Left 943240346 2:185376716-185376738 CCCTGCCCAGTGAGGCAGAATCT No data
Right 943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943240350 Original CRISPR CAGAATCTAGAGAAGCAGTC TGG Intergenic
No off target data available for this crispr