ID: 943241959

View in Genome Browser
Species Human (GRCh38)
Location 2:185396740-185396762
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943241952_943241959 23 Left 943241952 2:185396694-185396716 CCACAAGCAGCTTCTGCATTGGG No data
Right 943241959 2:185396740-185396762 CATGGTGGTACTCCAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr