ID: 943253888

View in Genome Browser
Species Human (GRCh38)
Location 2:185568127-185568149
Sequence TGTGCACTGGGGAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943253888_943253900 22 Left 943253888 2:185568127-185568149 CCACCCACTTTCCCCAGTGCACA No data
Right 943253900 2:185568172-185568194 GGCATGCCCAGACAAGCCCTGGG 0: 9
1: 9
2: 18
3: 41
4: 201
943253888_943253899 21 Left 943253888 2:185568127-185568149 CCACCCACTTTCCCCAGTGCACA No data
Right 943253899 2:185568171-185568193 GGGCATGCCCAGACAAGCCCTGG 0: 11
1: 9
2: 8
3: 20
4: 217
943253888_943253901 26 Left 943253888 2:185568127-185568149 CCACCCACTTTCCCCAGTGCACA No data
Right 943253901 2:185568176-185568198 TGCCCAGACAAGCCCTGGGCAGG 0: 9
1: 9
2: 2
3: 33
4: 327
943253888_943253896 0 Left 943253888 2:185568127-185568149 CCACCCACTTTCCCCAGTGCACA No data
Right 943253896 2:185568150-185568172 TGTCGGGCTCCAGTCTGCTGTGG No data
943253888_943253897 1 Left 943253888 2:185568127-185568149 CCACCCACTTTCCCCAGTGCACA No data
Right 943253897 2:185568151-185568173 GTCGGGCTCCAGTCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943253888 Original CRISPR TGTGCACTGGGGAAAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr