ID: 943255831

View in Genome Browser
Species Human (GRCh38)
Location 2:185591890-185591912
Sequence CCTAGAAGGAGGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943255831_943255841 25 Left 943255831 2:185591890-185591912 CCATCTTGGCTCCTCCTTCTAGG No data
Right 943255841 2:185591938-185591960 CGCTCCCCACACCCCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943255831 Original CRISPR CCTAGAAGGAGGAGCCAAGA TGG (reversed) Intergenic
No off target data available for this crispr