ID: 943268077

View in Genome Browser
Species Human (GRCh38)
Location 2:185763128-185763150
Sequence AAGCTGATATTGCTGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943268077_943268082 28 Left 943268077 2:185763128-185763150 CCTTGTCCCAGCAATATCAGCTT 0: 1
1: 0
2: 2
3: 23
4: 234
Right 943268082 2:185763179-185763201 CTAGGAGGTATAAATATTTCAGG 0: 1
1: 0
2: 3
3: 46
4: 627
943268077_943268081 13 Left 943268077 2:185763128-185763150 CCTTGTCCCAGCAATATCAGCTT 0: 1
1: 0
2: 2
3: 23
4: 234
Right 943268081 2:185763164-185763186 TTATCTCTTCTTTCTCTAGGAGG 0: 1
1: 0
2: 1
3: 29
4: 348
943268077_943268080 10 Left 943268077 2:185763128-185763150 CCTTGTCCCAGCAATATCAGCTT 0: 1
1: 0
2: 2
3: 23
4: 234
Right 943268080 2:185763161-185763183 AAGTTATCTCTTCTTTCTCTAGG 0: 1
1: 0
2: 5
3: 46
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943268077 Original CRISPR AAGCTGATATTGCTGGGACA AGG (reversed) Intronic
901439046 1:9266399-9266421 AAGCAGGTATTGCTGGCCCATGG - Exonic
903624712 1:24722152-24722174 TAGCTAATATAGCTGGGACATGG + Intergenic
903814413 1:26054202-26054224 AAGCTGCTGTTGCTGGAGCAAGG - Intronic
904653940 1:32028223-32028245 ATTCTGATATTGCTGGTCCAGGG - Intronic
907748416 1:57238162-57238184 ATGCTGATACTGCTGGCCCAAGG - Intronic
907952583 1:59197844-59197866 AAGCTGATGCTGCTGGTCCAGGG + Intergenic
908332031 1:63080689-63080711 ACCCTGATAATGCTGGTACATGG - Intergenic
908426687 1:64014387-64014409 AAGCTACTATTGATGGGTCAAGG + Intronic
909122371 1:71619366-71619388 AAGCTGTTTTTGCTGGGAGTAGG + Intronic
909876459 1:80811126-80811148 AAGATAATATTGCTGGAATAAGG + Intergenic
911443397 1:97959860-97959882 AAGATGACATTGCAGGGCCAGGG + Intergenic
911936784 1:103986528-103986550 AAGCTGATATTATTAGGACCTGG + Intergenic
912743973 1:112229438-112229460 AAGTAGATGTTGCTGGGTCACGG - Intergenic
913705163 1:121413700-121413722 AAGCTGATGTGGTTGGGGCAAGG + Intergenic
915491525 1:156252538-156252560 AAGCTCAGACTGCTGTGACAAGG + Intronic
916308025 1:163361507-163361529 AAGCTGATGTTGTTGGTTCAGGG + Intergenic
916609889 1:166381348-166381370 CAGTTGATATTGCTGGCAAATGG - Intergenic
916877990 1:168990854-168990876 ATGCTGCTATGGCAGGGACAGGG - Intergenic
917633509 1:176913618-176913640 AAGCGATTATTGCTGGGGCAGGG + Intronic
919468680 1:197952328-197952350 ATGCTGATGTTGCTGGTCCATGG + Intergenic
919780929 1:201220594-201220616 AAGATGATGTTTCTGGGCCATGG - Intronic
920128323 1:203711566-203711588 GAGCTGATATGGTTGGAACATGG + Intronic
921900064 1:220440695-220440717 AAGCTGATGCTGCTGGTCCAGGG + Intergenic
922492794 1:226031948-226031970 AAGCTGAGATGGCAGGGACTTGG + Intergenic
1064574635 10:16731886-16731908 AAGCCGATATTGTTGGGACAGGG + Intronic
1065313579 10:24440006-24440028 TAGCTGAAAGTGCTGGGAGAAGG + Intronic
1065544539 10:26806174-26806196 AAGCAGATATTCTTGGGGCAAGG - Intronic
1068784248 10:60953056-60953078 AACCTGACCTTGCTGGCACAAGG - Intronic
1070219600 10:74426724-74426746 AAAATGATATCACTGGGACAGGG + Intronic
1070448960 10:76538227-76538249 AAGGGGATATGGATGGGACAGGG - Intronic
1072903929 10:99433306-99433328 GAGCAGATATTGTGGGGACATGG - Intergenic
1073497298 10:103904729-103904751 CAAGTGATATGGCTGGGACAAGG + Intronic
1074793834 10:116920746-116920768 AAGTTGGTATGGCTGGAACATGG - Intronic
1075703845 10:124486736-124486758 AAACTGATACAGCTGGGCCAGGG + Intronic
1076510005 10:131006602-131006624 AAGCTGGTATTCCTAGGTCAGGG - Intergenic
1078506649 11:11954719-11954741 AACTTGGTATTTCTGGGACATGG + Intronic
1079313549 11:19388336-19388358 AAGCTGCTTTTTCTGGGACTGGG - Intronic
1080223413 11:29933668-29933690 AAACTGACATTTCTAGGACAAGG - Intergenic
1080757389 11:35215150-35215172 ATACTGACACTGCTGGGACAGGG + Intronic
1087196199 11:95306351-95306373 AAGCTGAGATTGAAGGGACAGGG + Intergenic
1089406975 11:118205735-118205757 AAGCTGAAATTGCTAGGAGAAGG + Intronic
1090602736 11:128389748-128389770 AAGGGGAGATTGCTGGGCCAAGG + Intergenic
1090750395 11:129741785-129741807 AAGGTGTCATTGCTGGGTCAAGG + Intergenic
1093161784 12:15755401-15755423 AAGCTCATCTTGGTGGGAAAGGG - Intronic
1093401436 12:18751960-18751982 AAGCTGTTAATTCTAGGACAAGG - Intergenic
1097994288 12:65870752-65870774 AAGATGACATCCCTGGGACAGGG + Intronic
1098649133 12:72941841-72941863 AAGCTGAAATTGCTGGGATTTGG + Intergenic
1098806885 12:75032142-75032164 AGGCTGATACTGCTGGGAGTTGG - Intergenic
1100226125 12:92557521-92557543 TAGCTGAAATTGCTGTGGCAAGG - Intergenic
1100527962 12:95437838-95437860 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
1101115979 12:101531761-101531783 AAGCTGATAATGCTGGGTAAAGG + Intergenic
1103854412 12:123955932-123955954 AAGATGACATGGCTGGGACTGGG - Intronic
1104206473 12:126643392-126643414 AAGATGTTATTACTGGGAAAAGG - Intergenic
1104642671 12:130477492-130477514 CAAGGGATATTGCTGGGACACGG - Intronic
1105054202 12:133081851-133081873 ATGCTGATACTGCTGGTCCAAGG - Intronic
1105842625 13:24268012-24268034 ATGCTGATACTGCTGGTCCATGG + Intronic
1106734130 13:32571947-32571969 AAGCTGTCCTTGTTGGGACAGGG - Intergenic
1107649842 13:42534348-42534370 AACCTGATATTTCTGTGACTCGG - Intergenic
1108770945 13:53699932-53699954 GAGCTGGGATGGCTGGGACATGG - Intergenic
1112025221 13:95405469-95405491 AGGCTGATATAGCTGAGAAAGGG + Intergenic
1112660846 13:101505891-101505913 AAGCGGAGCTTGCTGGGACTAGG + Intronic
1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG + Intergenic
1113358241 13:109603532-109603554 AAACTGAGATTCCTGGCACATGG - Intergenic
1113842697 13:113369407-113369429 GACCTGATCTTGCTGGGACGAGG + Intergenic
1116036045 14:39628025-39628047 AAGCTGCTATTGCCTGAACAAGG + Intergenic
1116486316 14:45453147-45453169 AGGCTGTCACTGCTGGGACAGGG - Intergenic
1116576983 14:46587519-46587541 AAGCTCATATTGCTGTCTCATGG - Intergenic
1118596034 14:67436417-67436439 GAGCTGGTATTGCAGGGCCAGGG - Intergenic
1120594735 14:86419640-86419662 AAGCTGCTATTGCTGGAAATGGG - Intergenic
1120610712 14:86637670-86637692 GTGCTGACATTACTGGGACAAGG + Intergenic
1122689258 14:103523846-103523868 AAGGGGAGATTGCTGGGTCACGG - Intergenic
1124029351 15:25995331-25995353 ATGCTGGTACTGCTGGTACATGG + Intergenic
1124639604 15:31389089-31389111 AAGCTGATCTTGCTGTCTCAGGG - Intronic
1125272161 15:37951830-37951852 AACTTCATATTGCTGAGACACGG + Intronic
1125807732 15:42508641-42508663 AAGCAGATATAACTGGGAGATGG - Intronic
1127342048 15:58057043-58057065 AAAGTGATATTGCTGGCTCATGG - Intronic
1128983195 15:72200894-72200916 AGGCTGATCTTGCTGGGTCAAGG - Intronic
1129406948 15:75326240-75326262 ATGCTGATGTTGCTGGCCCAGGG - Intergenic
1129610721 15:77053691-77053713 AAGTTGATATTACTGAGGCAAGG + Intronic
1130402812 15:83573401-83573423 ATGCTGATGTTGCTGGTCCAGGG - Intronic
1130771178 15:86925341-86925363 ATGCTGATACTGCTGGTCCAAGG + Intronic
1130990067 15:88870925-88870947 AAGCTGGTAGCGCTGGGGCATGG - Intronic
1135195931 16:20394671-20394693 AAGCTGACATTGCTGGCTTATGG + Intronic
1135888397 16:26334720-26334742 CAGCAGATATTGCAGGGAAAAGG + Intergenic
1136104911 16:28023468-28023490 CAGTTGAAATTGCTGGGGCAAGG + Intronic
1136750135 16:32628246-32628268 AAGGTGACAGTGCTGGGCCATGG - Intergenic
1138111281 16:54326091-54326113 GAGCTGATCTGGCTGGGACCAGG - Intergenic
1138151065 16:54657574-54657596 AAGTTGAGAATGCTGGGGCAAGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140525225 16:75617434-75617456 ATGCTGATGCTGCTGGTACAGGG - Intronic
1140819602 16:78650774-78650796 CAGCTGAGATTTGTGGGACAGGG - Intronic
1140936746 16:79678207-79678229 AAACTGGTATTGCTGGGTCCTGG + Intergenic
1142280715 16:89146281-89146303 AAACTCACATTCCTGGGACAGGG + Intronic
1203052265 16_KI270728v1_random:887445-887467 AAGGTGACAGTGCTGGGCCATGG - Intergenic
1144138078 17:12318409-12318431 ATGCTGATATTGCTGGTCCAAGG - Intergenic
1149516997 17:57288294-57288316 CAGCTGTTGTCGCTGGGACAGGG + Intronic
1150258807 17:63772121-63772143 AAGGTCATATTGCTGGTAAATGG - Intronic
1150322561 17:64228232-64228254 AAGCTGATTTTGCAGGGAGGAGG - Intronic
1152365534 17:79854231-79854253 TAGCTCATACTTCTGGGACAAGG + Intergenic
1153776492 18:8458759-8458781 ATGCTGATACTGCTGGGTCTGGG - Intergenic
1153976895 18:10276941-10276963 TAGCTGATATATCAGGGACAGGG - Intergenic
1155342072 18:24822926-24822948 AAGATGATATTGCAGGTGCAGGG - Intergenic
1156420395 18:36946425-36946447 ATGCTGATGTTGCTGGTCCAGGG - Intronic
1158476707 18:57786490-57786512 ATGCTGATGTTGCTGGTCCAGGG + Intronic
1158664270 18:59418343-59418365 AAGCTGATATTAATGGGGCCTGG + Intergenic
1159062452 18:63530214-63530236 AAGCCAGTATTGCTGGCACAAGG + Intergenic
1159149671 18:64505145-64505167 AAGCTGGAATGGCTGGAACATGG - Intergenic
1160437322 18:78861771-78861793 CAGGTGATATTCCTGGGACATGG - Intergenic
1161599238 19:5170747-5170769 AAGCTGAGAAGGCTGGGCCACGG + Intronic
1165430990 19:35772707-35772729 AACCTGATCTAGCTGGGTCACGG + Intergenic
1166210727 19:41305111-41305133 AAGATGAAATTTCTGGGCCAAGG - Intronic
1166778065 19:45324236-45324258 AATCTGAGCTTGCTGGGAAAGGG - Intergenic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
927290634 2:21401745-21401767 ATGCTGATACTGCTGGTTCAAGG + Intergenic
927340503 2:21978433-21978455 ATGCTGATATTGCTGGTCCCAGG - Intergenic
928246936 2:29638538-29638560 ATGCGGATAATGCTGGGGCAGGG + Intronic
929162550 2:38847018-38847040 AAGATGCAATTGCTGTGACAAGG - Exonic
929615487 2:43303935-43303957 ATGCTGATGCTGCTGGGGCAGGG + Intronic
929808093 2:45164990-45165012 AATCTGATATTTCAGGGAGATGG - Intergenic
930527942 2:52554750-52554772 ATGCTGATATTGCTGGTCCAGGG - Intergenic
930834917 2:55783041-55783063 AAGCTGGTATTGGAGGGCCAAGG + Intergenic
931220692 2:60285799-60285821 AAGCTGAGTTTGCAGGCACAAGG + Intergenic
931440808 2:62289073-62289095 ATGCTGATATTGCTGGTCCTGGG + Intergenic
932042655 2:68317747-68317769 ATGCTGATACTGCTGGTCCAGGG - Intronic
933295505 2:80486259-80486281 AACCTGAGCTTTCTGGGACAAGG - Intronic
933445717 2:82377629-82377651 AAGCTGAAGTGGCTGGGACATGG - Intergenic
933600284 2:84321937-84321959 ATGCTGATGCTGCTGGGCCATGG + Intergenic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
938030140 2:127985371-127985393 AAACTTAAATTGCTGGGACTAGG - Intronic
938626719 2:133117912-133117934 AAGCTGAGTTTGCTGAGATAAGG + Intronic
939220999 2:139301471-139301493 ATGCTGATAATGCTGGATCAAGG - Intergenic
940390792 2:153130412-153130434 AAGTTGATGTTTCTGGGACCAGG - Intergenic
942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG + Intergenic
942904765 2:181167061-181167083 CAGCTGGAATGGCTGGGACAAGG + Intergenic
943010852 2:182447287-182447309 AAGCAGATGAAGCTGGGACATGG + Intronic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
943417077 2:187620748-187620770 AAGCTGGTCTAGCTGGGTCAAGG + Intergenic
944556773 2:200894940-200894962 ATGCTGATGTTGCTGGTCCAAGG - Intronic
944658979 2:201904674-201904696 ATGCTGATGTTGCTGGTACAGGG - Intergenic
946377786 2:219324130-219324152 AATCTGATAATTCTGGGACATGG - Intergenic
946668654 2:222078195-222078217 AAGCTGTAATTGTTGAGACAGGG + Intergenic
948812993 2:240494523-240494545 AAGCTGTCACTGCTGGGACAGGG - Intronic
1168981296 20:2006185-2006207 AAACTGATACAGCTGGGGCAAGG + Intergenic
1170412284 20:16104625-16104647 ATGCTGATACTGCTGGGCAAGGG - Intergenic
1170737319 20:19023135-19023157 TGGCTGATATTGCTGGTCCAAGG - Intergenic
1172976818 20:38912329-38912351 ATGCTGATGTTGCTGGTACAGGG - Intronic
1174083276 20:47985814-47985836 GAACTGATATTGCTGGTTCATGG - Intergenic
1174132678 20:48357152-48357174 ATGCTGATGTTGCTGGTCCATGG + Intergenic
1174285794 20:49472166-49472188 AAAGTGATATTGCTGTGATAAGG - Intronic
1175170238 20:57075105-57075127 AAACTGAGATTGGTGTGACATGG + Intergenic
1175971321 20:62688029-62688051 AAGCTGGTGGTGCTGGGACCTGG - Intergenic
1177536821 21:22439183-22439205 ACGCTGATACTGCTGGTTCATGG - Intergenic
1177968395 21:27758615-27758637 AAGCTAAAATTGCTGGTTCAAGG + Intergenic
1178454518 21:32735739-32735761 ATGCTGATACTGCTGGTCCAGGG + Intronic
1179222982 21:39426007-39426029 AAGATCATATGGCTTGGACAAGG + Intronic
1181971509 22:26693869-26693891 AAGCTCATATAGCTGGTAAATGG - Intergenic
1184691965 22:46121570-46121592 AGGGTGACATTGCTGGGACCTGG + Intergenic
949370298 3:3327568-3327590 AAACTTTTATTTCTGGGACAAGG + Intergenic
950328545 3:12136953-12136975 AAGTTCATATTGGTGGGGCATGG + Intronic
952184718 3:30956162-30956184 AGGCTGATGTTGCTGGTCCATGG - Intergenic
953704880 3:45223697-45223719 ATGCTGATGTTGCTGGTCCAGGG + Intergenic
954510958 3:51124499-51124521 AAGCTGATTGTGCAGGGCCATGG + Intronic
954954798 3:54509668-54509690 ATGCTCATATTGCTGGAATAGGG - Intronic
955837061 3:63067662-63067684 ATGCTGATGTTGCTGGCCCATGG - Intergenic
956894043 3:73641460-73641482 ATGATGATATTGCTGTGAAATGG + Intergenic
957168595 3:76708403-76708425 TAGCTGTTATTTCTGGGAAATGG + Intronic
958739950 3:98057000-98057022 TAGCTGGAATTCCTGGGACAGGG + Intergenic
960047939 3:113214837-113214859 AAGCTTACTTTCCTGGGACAAGG - Intronic
961215562 3:125157579-125157601 GAGCTGAGTGTGCTGGGACAGGG - Intronic
962851793 3:139313628-139313650 AAGTGGATATTGCTAGGGCAGGG + Intronic
962970283 3:140394432-140394454 AAACTGATTCTGCTGAGACAAGG - Intronic
964805210 3:160602149-160602171 AAGGTGACATGGCTGGGTCATGG - Intergenic
965867802 3:173226575-173226597 AAGCTGATGCTGCTGGTCCAGGG + Intergenic
966927527 3:184655099-184655121 ATGCTGATGTTGCTGGTCCAGGG + Intronic
967935900 3:194727269-194727291 AACGTGAAATTGCTGGGTCATGG + Intergenic
968942707 4:3647064-3647086 AGGCTGATGATGCTAGGACAAGG + Intergenic
971134595 4:23854615-23854637 AAACTCATATTTGTGGGACAAGG - Intronic
972447800 4:39162836-39162858 ATGCTGATTTTGCTGGTCCAGGG - Intergenic
974847213 4:67365431-67365453 AACTTGATATTCCTTGGACAGGG + Intergenic
975425196 4:74217092-74217114 AAGCAGATATGGCTAGGGCAGGG - Intronic
975575965 4:75862980-75863002 AAACTGATACTGCTGCAACATGG + Intronic
976928302 4:90530314-90530336 AAACTGATATTGGTGGGCAAGGG + Intronic
977413172 4:96694202-96694224 ATGCTGATTTTACAGGGACATGG + Intergenic
981718887 4:147779156-147779178 ATGCTGATGTTGCTGGTTCAGGG + Intronic
981961169 4:150540775-150540797 AAGTTGATTTTGCTGACACAGGG - Intronic
981979213 4:150771321-150771343 TACCTTATATGGCTGGGACAAGG - Intronic
982100167 4:151959576-151959598 CTGCTGATATGGCAGGGACAAGG - Intergenic
982658574 4:158178814-158178836 AAGCTGATGCTGCTGGTTCAGGG - Intergenic
983701480 4:170600713-170600735 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
985726191 5:1516922-1516944 AAGCTCATGCTGCTGGCACATGG + Intronic
987551303 5:19385067-19385089 CAGCTGATAGAGCTGGGAGAGGG + Intergenic
989973613 5:50555197-50555219 AAGCTGATGTGGTTGGGGCAAGG - Intergenic
991434834 5:66587210-66587232 AAGCTATTATTGTTGGGGCAGGG - Intergenic
995549077 5:113262845-113262867 ATGCTGATACTGCTGGTTCACGG + Intronic
996465639 5:123799434-123799456 ATGCTGATACTGCTGGCCCAGGG + Intergenic
997614285 5:135235935-135235957 ATGCTGATGTTGCTGGTCCAGGG + Intronic
997622244 5:135306527-135306549 AAGCTGATGTGGCTCAGACAGGG + Intronic
997660990 5:135589487-135589509 AAGCTGATATTTCAGGGCCTTGG - Intergenic
998165401 5:139839815-139839837 AAGCTGATGCTGATGGGACCTGG + Intronic
998257773 5:140601693-140601715 ATGCTGAGACTGCTGGCACAGGG - Intergenic
998313604 5:141158231-141158253 ATACTGATAATTCTGGGACAGGG - Intergenic
999249268 5:150172484-150172506 AAGCTCATACAGCTAGGACATGG + Intronic
1000979150 5:167798260-167798282 AAGCTGATGGTGATGGGGCAGGG - Intronic
1002593426 5:180306527-180306549 AAGCTGATGGGGCAGGGACAGGG - Intronic
1003830150 6:10000544-10000566 ACGCTGATATTGCTGGCCCAGGG - Intronic
1004534775 6:16489957-16489979 ATGCTGATACTGCTGGTCCAGGG + Intronic
1004582594 6:16968617-16968639 ATGCTGATGTTGCTGGTTCAAGG + Intergenic
1004966984 6:20863172-20863194 ATGCTGATACTGCTGGTGCATGG + Intronic
1005739113 6:28774440-28774462 ACGCTGAACTTGCTGTGACACGG + Intergenic
1008081278 6:47196845-47196867 AAGCTGATGCTGCTGGTTCAGGG - Intergenic
1008391223 6:50954304-50954326 ATGCTGATGTTGCTGGTCCAAGG + Intergenic
1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG + Intronic
1010760600 6:79718259-79718281 AAACTGAGAGTGCTGGGAAAAGG - Intergenic
1012998958 6:106002361-106002383 TTGTTGATGTTGCTGGGACATGG + Intergenic
1013577812 6:111502268-111502290 TAGCAGAGATTGCTGGTACAAGG + Intergenic
1014987546 6:128030126-128030148 GAGCTGATAGTGCTGGGAGATGG + Intronic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1016349774 6:143154742-143154764 AAGATGATATCGCTGGGGGAAGG + Intronic
1016356377 6:143223188-143223210 ATGCTGATGCTGCTGGCACAGGG - Intronic
1017547572 6:155468422-155468444 AGGCTGGGATGGCTGGGACATGG + Intergenic
1017650934 6:156581988-156582010 CAGCTGATAGAGATGGGACATGG + Intergenic
1017873135 6:158502941-158502963 AAGCTGACAGTGCTGGGACAGGG - Exonic
1020503568 7:8954534-8954556 AAGCTGATAATGCTTGGAGGTGG - Intergenic
1021599266 7:22348609-22348631 TGGCTGGTATTGCTGGGAGATGG + Intronic
1022293910 7:29031613-29031635 AAGTTGAAATTACTGGGACAAGG - Intronic
1022480477 7:30740231-30740253 ACGCTGACATTGCTGGTCCAGGG - Intronic
1028123169 7:87080342-87080364 AAGAAGATATTCCTGGGAGAAGG + Intergenic
1030084632 7:105805968-105805990 ATGCTGAGCTTGCTGGAACAAGG + Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1036724857 8:11210819-11210841 AAGGTGATATAGCTGGTAAATGG - Intergenic
1037196254 8:16193935-16193957 CAACTGATATTTCTGGGAGAAGG + Intronic
1037352942 8:17982115-17982137 AAGCTTACATTGCTAGGAAATGG + Intronic
1037604935 8:20430147-20430169 GAACTGATATGGCAGGGACATGG + Intergenic
1038078866 8:24109463-24109485 AAGGTGATAATGCCTGGACAAGG + Intergenic
1039072926 8:33662488-33662510 ATGCTGATGTTGCTGGCCCAGGG + Intergenic
1039593759 8:38771938-38771960 ATGCTGATGTTGCTGGCCCAGGG + Intronic
1040567963 8:48583306-48583328 AAGCTGAGATTCTTGGGCCATGG + Intergenic
1041190540 8:55349431-55349453 AAGGTGATATGGCTGAGAGATGG - Intronic
1043425732 8:80146917-80146939 ATGCTGATACTGCTGGTTCAGGG - Intronic
1047787050 8:128163490-128163512 GACCTGATATTGCCTGGACATGG - Intergenic
1050250535 9:3739392-3739414 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
1052614775 9:30823832-30823854 AAACTGATGTTGCTGGGAAAAGG - Intergenic
1056105998 9:83346855-83346877 ATGCTGACATTGCTGGCCCAGGG + Intronic
1057803266 9:98202887-98202909 AAGTAGAAATTGCTGGGTCAGGG + Intronic
1061903000 9:133682501-133682523 AAGCTCATCTGGCTGGGACATGG - Intronic
1062519850 9:136953115-136953137 AAGCTGCCTGTGCTGGGACAGGG - Intronic
1185758053 X:2667907-2667929 AAGCTGATGGTGTTCGGACATGG + Intergenic
1186368958 X:8927118-8927140 AGGCTGATAGTGCTTTGACATGG - Intergenic
1186610004 X:11129784-11129806 ATGCTGATGCTGCTGGGCCAGGG + Intergenic
1187021572 X:15387930-15387952 ATGCTGATACTGCTGGTCCATGG + Intronic
1187590485 X:20712175-20712197 ATACTGATATTGCTGGTCCAAGG + Intergenic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1192226873 X:69234963-69234985 AAGGTCATATAGCTAGGACATGG - Intergenic
1193174719 X:78378912-78378934 AAGCTGACATTTCTTGGAAATGG + Intergenic
1193319138 X:80099250-80099272 AAGCTGGGATTGCAGGCACATGG - Intergenic
1194702763 X:97134634-97134656 ATACTGATATTGCTGGTCCAGGG + Intronic
1196291189 X:113943303-113943325 TAGATGATATTCCTGGAACATGG - Intergenic
1196324309 X:114384334-114384356 AAGGTGATATATCTGGTACATGG - Intergenic
1196396155 X:115263513-115263535 AAGCTATTATTGATGGGACTTGG + Intergenic
1197717402 X:129719387-129719409 ATGCTGATGTTGCTGGTCCAGGG + Intergenic