ID: 943275201

View in Genome Browser
Species Human (GRCh38)
Location 2:185857957-185857979
Sequence ATGTGGCTTTATTGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943275201_943275205 -9 Left 943275201 2:185857957-185857979 CCTATTTCCCAATAAAGCCACAT No data
Right 943275205 2:185857971-185857993 AAGCCACATTATAAGTTACTGGG No data
943275201_943275208 16 Left 943275201 2:185857957-185857979 CCTATTTCCCAATAAAGCCACAT No data
Right 943275208 2:185857996-185858018 TTGAAACTTTAACTATTTTGAGG No data
943275201_943275209 17 Left 943275201 2:185857957-185857979 CCTATTTCCCAATAAAGCCACAT No data
Right 943275209 2:185857997-185858019 TGAAACTTTAACTATTTTGAGGG No data
943275201_943275206 -8 Left 943275201 2:185857957-185857979 CCTATTTCCCAATAAAGCCACAT No data
Right 943275206 2:185857972-185857994 AGCCACATTATAAGTTACTGGGG No data
943275201_943275204 -10 Left 943275201 2:185857957-185857979 CCTATTTCCCAATAAAGCCACAT No data
Right 943275204 2:185857970-185857992 AAAGCCACATTATAAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943275201 Original CRISPR ATGTGGCTTTATTGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr