ID: 943276876

View in Genome Browser
Species Human (GRCh38)
Location 2:185878540-185878562
Sequence TCTTCTAGGCAGCAGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943276876_943276884 22 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276884 2:185878585-185878607 ACCCACAGACTCAATGGAAAGGG No data
943276876_943276882 16 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276882 2:185878579-185878601 AAAGACACCCACAGACTCAATGG No data
943276876_943276880 -9 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276880 2:185878554-185878576 CCTAGAAGAGATCGATGGAATGG No data
943276876_943276886 23 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276886 2:185878586-185878608 CCCACAGACTCAATGGAAAGGGG No data
943276876_943276881 -8 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276881 2:185878555-185878577 CTAGAAGAGATCGATGGAATGGG No data
943276876_943276883 21 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276883 2:185878584-185878606 CACCCACAGACTCAATGGAAAGG No data
943276876_943276888 26 Left 943276876 2:185878540-185878562 CCAACCATCTGCTGCCTAGAAGA No data
Right 943276888 2:185878589-185878611 ACAGACTCAATGGAAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943276876 Original CRISPR TCTTCTAGGCAGCAGATGGT TGG (reversed) Intergenic
No off target data available for this crispr