ID: 943278011

View in Genome Browser
Species Human (GRCh38)
Location 2:185893015-185893037
Sequence CTTTTTCAGCACCTGTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943278011_943278018 22 Left 943278011 2:185893015-185893037 CCAATAAACAGGTGCTGAAAAAG No data
Right 943278018 2:185893060-185893082 TAGGGGTGAACATCTGTAAAGGG No data
943278011_943278015 4 Left 943278011 2:185893015-185893037 CCAATAAACAGGTGCTGAAAAAG No data
Right 943278015 2:185893042-185893064 GGGATACAAGATATTTACTAGGG No data
943278011_943278017 21 Left 943278011 2:185893015-185893037 CCAATAAACAGGTGCTGAAAAAG No data
Right 943278017 2:185893059-185893081 CTAGGGGTGAACATCTGTAAAGG No data
943278011_943278014 3 Left 943278011 2:185893015-185893037 CCAATAAACAGGTGCTGAAAAAG No data
Right 943278014 2:185893041-185893063 TGGGATACAAGATATTTACTAGG No data
943278011_943278016 5 Left 943278011 2:185893015-185893037 CCAATAAACAGGTGCTGAAAAAG No data
Right 943278016 2:185893043-185893065 GGATACAAGATATTTACTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943278011 Original CRISPR CTTTTTCAGCACCTGTTTAT TGG (reversed) Intergenic
No off target data available for this crispr