ID: 943297188

View in Genome Browser
Species Human (GRCh38)
Location 2:186154207-186154229
Sequence TCTCACACGGGGCAGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943297180_943297188 15 Left 943297180 2:186154169-186154191 CCAGATGGGGTGGCTGCCGGGCG 0: 278
1: 1047
2: 1380
3: 2469
4: 3112
Right 943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG No data
943297183_943297188 -1 Left 943297183 2:186154185-186154207 CCGGGCGGAGAGGCTCCTCACTT 0: 275
1: 2694
2: 8362
3: 5948
4: 4283
Right 943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG No data
943297179_943297188 16 Left 943297179 2:186154168-186154190 CCCAGATGGGGTGGCTGCCGGGC 0: 236
1: 870
2: 3957
3: 4312
4: 3171
Right 943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG No data
943297176_943297188 24 Left 943297176 2:186154160-186154182 CCTCACTTCCCAGATGGGGTGGC 0: 532
1: 2666
2: 5168
3: 10303
4: 6855
Right 943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943297188 Original CRISPR TCTCACACGGGGCAGCTGCC AGG Intergenic
No off target data available for this crispr