ID: 943298249

View in Genome Browser
Species Human (GRCh38)
Location 2:186164614-186164636
Sequence GATACTACCCCTGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943298249_943298253 -7 Left 943298249 2:186164614-186164636 CCCTTCCCAGCAGGGGTAGTATC No data
Right 943298253 2:186164630-186164652 TAGTATCAGTTGAAGTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943298249 Original CRISPR GATACTACCCCTGCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr