ID: 943299369

View in Genome Browser
Species Human (GRCh38)
Location 2:186178675-186178697
Sequence ATATAGTTGCAGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943299369_943299373 -6 Left 943299369 2:186178675-186178697 CCACCCTCAATCTGCAACTATAT No data
Right 943299373 2:186178692-186178714 CTATATGAAAAAATGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943299369 Original CRISPR ATATAGTTGCAGATTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr