ID: 943300229

View in Genome Browser
Species Human (GRCh38)
Location 2:186189041-186189063
Sequence TAGGCCAAGCATAATGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943300229_943300232 9 Left 943300229 2:186189041-186189063 CCAATGTCATTATGCTTGGCCTA No data
Right 943300232 2:186189073-186189095 GGAACATTTCAATTGATAGCTGG No data
943300229_943300234 30 Left 943300229 2:186189041-186189063 CCAATGTCATTATGCTTGGCCTA No data
Right 943300234 2:186189094-186189116 GGACCTATAGGAAATTGCATAGG No data
943300229_943300233 18 Left 943300229 2:186189041-186189063 CCAATGTCATTATGCTTGGCCTA No data
Right 943300233 2:186189082-186189104 CAATTGATAGCTGGACCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943300229 Original CRISPR TAGGCCAAGCATAATGACAT TGG (reversed) Intergenic
No off target data available for this crispr