ID: 943301862

View in Genome Browser
Species Human (GRCh38)
Location 2:186212627-186212649
Sequence GGAAAGGCTTTCCTTCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943301862_943301865 3 Left 943301862 2:186212627-186212649 CCAATCTGAAGGAAAGCCTTTCC No data
Right 943301865 2:186212653-186212675 GACTCAACACCATTGCTTGCAGG No data
943301862_943301867 13 Left 943301862 2:186212627-186212649 CCAATCTGAAGGAAAGCCTTTCC No data
Right 943301867 2:186212663-186212685 CATTGCTTGCAGGTTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943301862 Original CRISPR GGAAAGGCTTTCCTTCAGAT TGG (reversed) Intergenic
No off target data available for this crispr