ID: 943301865

View in Genome Browser
Species Human (GRCh38)
Location 2:186212653-186212675
Sequence GACTCAACACCATTGCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943301862_943301865 3 Left 943301862 2:186212627-186212649 CCAATCTGAAGGAAAGCCTTTCC No data
Right 943301865 2:186212653-186212675 GACTCAACACCATTGCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943301865 Original CRISPR GACTCAACACCATTGCTTGC AGG Intergenic
No off target data available for this crispr