ID: 943301883

View in Genome Browser
Species Human (GRCh38)
Location 2:186213065-186213087
Sequence CCATCTCATCAGGTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943301878_943301883 27 Left 943301878 2:186213015-186213037 CCAAGATATTAAAGGAGAGAAAG No data
Right 943301883 2:186213065-186213087 CCATCTCATCAGGTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943301883 Original CRISPR CCATCTCATCAGGTGATGCA GGG Intergenic
No off target data available for this crispr