ID: 943307031

View in Genome Browser
Species Human (GRCh38)
Location 2:186275702-186275724
Sequence AAGGGGCAAGAGAGCTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943307023_943307031 25 Left 943307023 2:186275654-186275676 CCTCAGGTTTATAGAAGGCCATC No data
Right 943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG No data
943307022_943307031 26 Left 943307022 2:186275653-186275675 CCCTCAGGTTTATAGAAGGCCAT No data
Right 943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG No data
943307026_943307031 -4 Left 943307026 2:186275683-186275705 CCATGTCCTCACATGGTCAAAGG No data
Right 943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG No data
943307024_943307031 7 Left 943307024 2:186275672-186275694 CCATCTTTCTGCCATGTCCTCAC No data
Right 943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG No data
943307030_943307031 -10 Left 943307030 2:186275689-186275711 CCTCACATGGTCAAAGGGGCAAG No data
Right 943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943307031 Original CRISPR AAGGGGCAAGAGAGCTCTTC AGG Intergenic
No off target data available for this crispr