ID: 943307493

View in Genome Browser
Species Human (GRCh38)
Location 2:186282260-186282282
Sequence CATTTACACTGAAGCTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943307493_943307494 28 Left 943307493 2:186282260-186282282 CCATGTAAGCTTCAGTGTAAATG No data
Right 943307494 2:186282311-186282333 AAAATTATAATTTGCATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943307493 Original CRISPR CATTTACACTGAAGCTTACA TGG (reversed) Intergenic
No off target data available for this crispr