ID: 943316375

View in Genome Browser
Species Human (GRCh38)
Location 2:186393641-186393663
Sequence GGCTGACATTCTTTTGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943316373_943316375 5 Left 943316373 2:186393613-186393635 CCAAAAATTTTACACTAGAACAA No data
Right 943316375 2:186393641-186393663 GGCTGACATTCTTTTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943316375 Original CRISPR GGCTGACATTCTTTTGTGAA AGG Intergenic
No off target data available for this crispr