ID: 943319887

View in Genome Browser
Species Human (GRCh38)
Location 2:186433371-186433393
Sequence GGTTTGCCCAGAAACTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943319887_943319888 -8 Left 943319887 2:186433371-186433393 CCAGATAAGTTTCTGGGCAAACC No data
Right 943319888 2:186433386-186433408 GGCAAACCTGCTTACACTGACGG No data
943319887_943319891 1 Left 943319887 2:186433371-186433393 CCAGATAAGTTTCTGGGCAAACC No data
Right 943319891 2:186433395-186433417 GCTTACACTGACGGTTATGGAGG No data
943319887_943319892 5 Left 943319887 2:186433371-186433393 CCAGATAAGTTTCTGGGCAAACC No data
Right 943319892 2:186433399-186433421 ACACTGACGGTTATGGAGGCTGG No data
943319887_943319890 -2 Left 943319887 2:186433371-186433393 CCAGATAAGTTTCTGGGCAAACC No data
Right 943319890 2:186433392-186433414 CCTGCTTACACTGACGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943319887 Original CRISPR GGTTTGCCCAGAAACTTATC TGG (reversed) Intergenic
No off target data available for this crispr