ID: 943320396

View in Genome Browser
Species Human (GRCh38)
Location 2:186436711-186436733
Sequence TGACCAATGTTTCCAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943320392_943320396 16 Left 943320392 2:186436672-186436694 CCAACTGCATTGTGGACTGGGCC No data
Right 943320396 2:186436711-186436733 TGACCAATGTTTCCAACAGATGG No data
943320395_943320396 -6 Left 943320395 2:186436694-186436716 CCACACTTATGCTGAGGTGACCA No data
Right 943320396 2:186436711-186436733 TGACCAATGTTTCCAACAGATGG No data
943320394_943320396 -5 Left 943320394 2:186436693-186436715 CCCACACTTATGCTGAGGTGACC No data
Right 943320396 2:186436711-186436733 TGACCAATGTTTCCAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943320396 Original CRISPR TGACCAATGTTTCCAACAGA TGG Intergenic
No off target data available for this crispr