ID: 943324312

View in Genome Browser
Species Human (GRCh38)
Location 2:186479816-186479838
Sequence AAAAATCCCCAGATGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943324310_943324312 -10 Left 943324310 2:186479803-186479825 CCATTATTATTGGAAAAATCCCC No data
Right 943324312 2:186479816-186479838 AAAAATCCCCAGATGTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943324312 Original CRISPR AAAAATCCCCAGATGTATCA GGG Intergenic
No off target data available for this crispr