ID: 943325131

View in Genome Browser
Species Human (GRCh38)
Location 2:186488353-186488375
Sequence CAGCCACTAATTTTTTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943325128_943325131 26 Left 943325128 2:186488304-186488326 CCACTAAATTTGTTTTGTGCCTC No data
Right 943325131 2:186488353-186488375 CAGCCACTAATTTTTTTGACAGG No data
943325127_943325131 27 Left 943325127 2:186488303-186488325 CCCACTAAATTTGTTTTGTGCCT No data
Right 943325131 2:186488353-186488375 CAGCCACTAATTTTTTTGACAGG No data
943325129_943325131 7 Left 943325129 2:186488323-186488345 CCTCTTTCTATTTAATTCTTTCC No data
Right 943325131 2:186488353-186488375 CAGCCACTAATTTTTTTGACAGG No data
943325126_943325131 28 Left 943325126 2:186488302-186488324 CCCCACTAAATTTGTTTTGTGCC No data
Right 943325131 2:186488353-186488375 CAGCCACTAATTTTTTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943325131 Original CRISPR CAGCCACTAATTTTTTTGAC AGG Intronic
No off target data available for this crispr