ID: 943325458

View in Genome Browser
Species Human (GRCh38)
Location 2:186492121-186492143
Sequence CTGTAGTTACAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943325456_943325458 1 Left 943325456 2:186492097-186492119 CCTTATTTATTCATTGTTTCTTC No data
Right 943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943325458 Original CRISPR CTGTAGTTACAGATGGAGCA TGG Intronic
No off target data available for this crispr