ID: 943326560

View in Genome Browser
Species Human (GRCh38)
Location 2:186505820-186505842
Sequence CCTCATCACCACCTGTTCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943326560 Original CRISPR CCTCATCACCACCTGTTCCC TGG (reversed) Exonic
900177887 1:1298744-1298766 CCTCACCCCCACCTGTGCTCCGG - Intronic
901242276 1:7702444-7702466 CCAAATCACCACGAGTTCCCCGG + Intronic
901452906 1:9346698-9346720 CCTCACCTCCTCCTCTTCCCTGG + Intronic
901700839 1:11044157-11044179 TCTCATCACCCCCTTTCCCCAGG + Intronic
901705394 1:11069365-11069387 CCTCATTACCACCTCCTCCATGG - Intronic
901735331 1:11308752-11308774 ACTCATCCCCACCAGTTTCCAGG + Intergenic
902389429 1:16094517-16094539 TGTCATCTCCAGCTGTTCCCAGG + Intergenic
902671469 1:17977416-17977438 CATCTTCACCACCTGCTCCTTGG - Intergenic
902888950 1:19427534-19427556 CCCCAGCACAAACTGTTCCCGGG - Intronic
903714068 1:25350461-25350483 GCTCACCACAACCTGTTTCCCGG + Intronic
903779782 1:25813948-25813970 CTTCATCAGCACCTGGTCCCTGG + Exonic
904654838 1:32037022-32037044 CTCCTCCACCACCTGTTCCCAGG + Exonic
904889125 1:33764668-33764690 CCTAATCACAAACAGTTCCCAGG + Intronic
905008957 1:34733869-34733891 CCTCTCCACCACCTGATCCCAGG + Intronic
905294782 1:36947307-36947329 CCCCATCACTACCTGCACCCAGG + Intronic
905417644 1:37815343-37815365 TCTCTTCAGCCCCTGTTCCCGGG - Exonic
905966799 1:42105041-42105063 CCTCCTCACTGCCTGTACCCAGG - Intergenic
906092873 1:43197636-43197658 CCTTATAGCCACCTGTTCTCTGG + Exonic
906209168 1:44002714-44002736 CCTAATCACCACCAGCCCCCTGG + Intronic
906215551 1:44036161-44036183 CCTGCTCCCCACCTGCTCCCTGG - Intergenic
906723672 1:48027846-48027868 CTTTATCACCTCCTGCTCCCTGG + Intergenic
906822124 1:48940654-48940676 CATCATAAGCACCTTTTCCCAGG - Intronic
908721470 1:67130905-67130927 CCTCACCTCCACTTTTTCCCAGG - Intronic
909480547 1:76125270-76125292 CCTCCTCCTTACCTGTTCCCTGG + Intronic
909899675 1:81116684-81116706 CCTCATCTTCACCTGTCCCCAGG + Intergenic
911239539 1:95449811-95449833 CCTCTTCAGCACCTCTTTCCTGG + Intergenic
911577539 1:99596317-99596339 CCTCATGCCCACCTGGTCCCTGG - Intergenic
912499572 1:110113100-110113122 CCTCATCCTTACGTGTTCCCTGG + Exonic
914915243 1:151815437-151815459 CCTCATAAACCCCTGGTCCCTGG - Intronic
917344204 1:174012094-174012116 CCTCATCCCCACCTGGTAGCTGG - Intronic
918070731 1:181131813-181131835 CCTCAGCACCAGCTGGTCACTGG - Intergenic
918185393 1:182122259-182122281 CCTCATTACCACCCCTTCCCTGG + Intergenic
919196528 1:194294247-194294269 CCTAACCACCACCTCTTCCCAGG + Intergenic
920092616 1:203465073-203465095 CCTCCTCCCCACATGGTCCCTGG - Intergenic
920436349 1:205949512-205949534 CCTCACCTCCACATGCTCCCTGG + Intergenic
920651981 1:207844570-207844592 CCTCACCACCATCTGTCTCCAGG - Intergenic
921669344 1:217908841-217908863 CCTCAGCACCACCTTTTCCCAGG + Intergenic
923056142 1:230426602-230426624 CCCCCTCCCCTCCTGTTCCCCGG - Intergenic
923591111 1:235320441-235320463 CCTCACCACCATCTCTCCCCAGG + Intronic
1062978602 10:1703276-1703298 CCTCCTCATCAGGTGTTCCCTGG - Intronic
1065278596 10:24112331-24112353 CCTCATGACCATCTGTTCCTGGG - Intronic
1065703710 10:28450071-28450093 TCTCATCACACTCTGTTCCCTGG - Intergenic
1067097963 10:43314826-43314848 CCTCCTCCCCACCAGTTGCCAGG - Intergenic
1067349925 10:45466414-45466436 CGTCTTCATCACCTGTCCCCAGG + Intronic
1067692048 10:48508297-48508319 CCTCATGACCAGCTGTTACTGGG + Intronic
1067768503 10:49107554-49107576 CCCCACCACCACCTCTACCCAGG + Intronic
1069717988 10:70532923-70532945 CCCCCTCACCCCCTATTCCCGGG - Intronic
1069782254 10:70964318-70964340 TCTCAGCAGCTCCTGTTCCCAGG - Intergenic
1070480590 10:76878802-76878824 CCTCATCCCCACCTCTTTCTAGG + Intronic
1070678640 10:78433421-78433443 CCTCATGGCACCCTGTTCCCAGG - Intergenic
1071705415 10:87992876-87992898 CCTCTTCCTCACCTGATCCCAGG + Intergenic
1073847318 10:107571951-107571973 ACCAAACACCACCTGTTCCCTGG + Intergenic
1075654077 10:124149890-124149912 CCTCCCCACCACCTGCTCCCAGG + Intergenic
1075922694 10:126226171-126226193 CCCCACCACCACCTTTCCCCAGG - Intronic
1078050396 11:7960726-7960748 TCTCATCACCACCCGGCCCCTGG - Exonic
1078433996 11:11309575-11309597 CCTTCTCCACACCTGTTCCCTGG + Intronic
1082002300 11:47400066-47400088 CCTCATCCCCCACTGCTCCCTGG + Intergenic
1082764428 11:57155974-57155996 CTCCATCACATCCTGTTCCCGGG - Intergenic
1082792285 11:57354620-57354642 ACACAACATCACCTGTTCCCAGG - Intronic
1082802741 11:57426598-57426620 CCGCTTCTCCACCTGCTCCCGGG - Exonic
1082962067 11:58927877-58927899 CCTTATCACCTCGTCTTCCCTGG - Intronic
1084427759 11:69094854-69094876 CCCCAGCAGCACCTGTTGCCAGG + Intergenic
1084945604 11:72636763-72636785 CCTCATCACCCCCGCTTACCTGG + Intronic
1085115470 11:73927801-73927823 CCTCAGCACTCCCTGTTGCCTGG + Intergenic
1088804291 11:113337792-113337814 CCCCATCACCACCTCTTGCTTGG - Intronic
1089064935 11:115655541-115655563 CCTCAAAACCATCTGTTCTCGGG - Intergenic
1090022805 11:123142578-123142600 CCTCATCCACAACTGTTCCTAGG - Intronic
1091165507 11:133472436-133472458 CCTCTTCCCCACCTTTGCCCAGG - Intronic
1092078269 12:5691465-5691487 CCTCATCACCATCTCAGCCCTGG - Intronic
1093027137 12:14255310-14255332 CATGGTCCCCACCTGTTCCCTGG + Intergenic
1093441557 12:19203455-19203477 TCTCCACACCACCAGTTCCCAGG + Intronic
1095762324 12:45853652-45853674 AGTCGTCACCACCTGTTTCCTGG + Intronic
1097169617 12:57105457-57105479 CCTCGTCACCAGGTATTCCCCGG - Exonic
1101067842 12:101041250-101041272 CCTTATCACCAAGTGTTCCAAGG + Intronic
1101346931 12:103894542-103894564 CCTCCTGACCACCCTTTCCCTGG + Intergenic
1102310751 12:111842585-111842607 CCTCATCCCCACCGGTCCCGAGG + Intronic
1103558353 12:121779283-121779305 CCACATCACCACCATGTCCCAGG + Exonic
1103948597 12:124540285-124540307 CCTCATGGACACCTGTTCCTCGG - Intronic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1104847290 12:131852864-131852886 CCTGTTCACCATCTGCTCCCTGG + Intergenic
1109091294 13:58049613-58049635 CCTCATCACCACCTCTACCAGGG - Intergenic
1113025667 13:105938378-105938400 TCTCATCACCACCAGTTCACAGG + Intergenic
1114883271 14:26813587-26813609 CCACACCACCACATGCTCCCAGG - Intergenic
1115989490 14:39137747-39137769 CATGATCACCCCTTGTTCCCAGG + Intergenic
1119293394 14:73514068-73514090 CCGCAGGACCACCAGTTCCCAGG + Exonic
1121746447 14:96298186-96298208 GCTCAGCATCACCTGTTACCAGG + Intronic
1122631366 14:103109153-103109175 CCTCTCCACCACCTGTCCCCCGG + Intronic
1122901115 14:104782681-104782703 CCTGATCGCCGTCTGTTCCCTGG - Intronic
1123744341 15:23307033-23307055 CCTTTTTATCACCTGTTCCCTGG + Intergenic
1124560874 15:30771941-30771963 CCACGTCTCCACCTCTTCCCAGG - Intronic
1124561057 15:30773943-30773965 CCTCACCACAGCCTCTTCCCTGG + Intergenic
1124669473 15:31625116-31625138 CCTCACCACAGCCTCTTCCCTGG - Intronic
1125430538 15:39589065-39589087 CCTCATCAACATCTGTGCACTGG - Exonic
1125724797 15:41862718-41862740 CCTCCTCCCCACTTGTGCCCAGG + Intronic
1128806931 15:70538146-70538168 CCTCCCCACCTCCTGCTCCCTGG + Intergenic
1129249905 15:74303073-74303095 CCTCAGCACCACCTGGTGGCAGG + Intronic
1129829956 15:78662115-78662137 CTTCATTAACACCTGTGCCCTGG - Intronic
1130575955 15:85093384-85093406 CCTCAACAAGCCCTGTTCCCCGG - Intronic
1130882495 15:88067155-88067177 CCTCAGCACCACGTGTTGCATGG - Intronic
1131770496 15:95731847-95731869 CATCTTCACCACCTTGTCCCAGG - Intergenic
1132802304 16:1760433-1760455 CCTCAGCACCTCCTGCTCCCCGG - Exonic
1133323591 16:4930187-4930209 TCTCATCTCCAACTGATCCCCGG + Intronic
1134022888 16:10933648-10933670 CCTTAGCCCCACCTGTTCCCAGG + Intronic
1134862273 16:17571128-17571150 CCTCCTCACAGCCTGTGCCCTGG + Intergenic
1136375026 16:29860372-29860394 CCTCATTCCCACTTGTTCCCTGG + Intronic
1138433349 16:56983428-56983450 CCTCACCAGCCCCTGTTCCTGGG + Intronic
1139074485 16:63427407-63427429 CCCCATTTCCACCTGTTCACTGG - Intergenic
1139546426 16:67651995-67652017 CCCCCTCACCAGCTGATCCCGGG - Exonic
1141346814 16:83254157-83254179 ACTCATAACCACCTGATGCCTGG - Intronic
1141832138 16:86515773-86515795 CCTAATCAGCCCCTCTTCCCCGG - Intergenic
1141982597 16:87559789-87559811 CGTCATCACCAAATGTTCCCTGG + Intergenic
1142074493 16:88109532-88109554 GCTCAGCACCTCCTGATCCCAGG - Intronic
1142215181 16:88826411-88826433 CCTCATCCCTGCCTGTACCCGGG - Intronic
1142362788 16:89635256-89635278 CCTCACCACCACCAGCTCCTGGG + Intronic
1142750957 17:1987262-1987284 CCCAATCAACACCTGCTCCCAGG + Intronic
1143200336 17:5109045-5109067 CCTGATCACCTCCAGGTCCCAGG - Exonic
1143258839 17:5583718-5583740 CCTCAGCCCCATCTGCTCCCAGG + Exonic
1143864366 17:9913189-9913211 CATCGCCACCACCTTTTCCCAGG - Intronic
1144213671 17:13036007-13036029 TCTCATCCCCTCCTGGTCCCAGG + Intergenic
1144705211 17:17363584-17363606 CCCCATCACCACCACCTCCCCGG - Intergenic
1145040880 17:19577453-19577475 CCGCAGCACCAGCTGTTTCCTGG - Exonic
1146122914 17:30210752-30210774 GCTGATCATCACCAGTTCCCCGG + Intronic
1147570788 17:41569591-41569613 CCTCATCTCCCCTTCTTCCCTGG - Intronic
1147723486 17:42552951-42552973 GCTCATCACCGGCTGTTCCTCGG + Exonic
1147767113 17:42844665-42844687 CCTCATTACCATCTTTGCCCTGG + Exonic
1148597940 17:48871887-48871909 CATCTTCAACATCTGTTCCCTGG + Intergenic
1149097232 17:52857576-52857598 TCTCAAAACCACCTATTCCCAGG + Intergenic
1149404397 17:56332279-56332301 CTTCACAAGCACCTGTTCCCTGG - Intronic
1149626243 17:58083009-58083031 CCTCAGCCCCATCTGTTCCCTGG + Intergenic
1149626551 17:58084012-58084034 CCTCTCCACCCCCTCTTCCCCGG - Intronic
1150302468 17:64057801-64057823 CTTCATCATCACCTATCCCCTGG - Exonic
1150619319 17:66797556-66797578 CCTCATGCCCACTAGTTCCCTGG + Intronic
1151268863 17:72977903-72977925 CTGCATCGGCACCTGTTCCCAGG + Intronic
1151694079 17:75705241-75705263 CCTGAGCACCACTTGTTCCCTGG + Intronic
1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG + Intergenic
1154274347 18:12947120-12947142 CCTCTTCACTTCCTTTTCCCCGG + Intronic
1154383054 18:13869823-13869845 CCTCACCACCACTTCTTCCCAGG + Intergenic
1157132128 18:45016804-45016826 CCTCCCCACCTCCTATTCCCCGG + Intronic
1157517705 18:48322370-48322392 CCTCACCACCAAATGTCCCCTGG + Intronic
1160693362 19:470535-470557 CGTCAGCACCCCCTGTCCCCAGG - Intronic
1160752958 19:743317-743339 CCTCAGCCTCACCTGGTCCCTGG + Intronic
1161101440 19:2423969-2423991 CCCCATCACAACCTACTCCCTGG + Intronic
1161952501 19:7475713-7475735 CCACATGACCACCTGGTCACAGG - Intergenic
1163423693 19:17229146-17229168 CCAGATCTCAACCTGTTCCCTGG + Exonic
1164696049 19:30245158-30245180 CCTCATCCTCACCTTTTACCTGG + Intronic
1165431920 19:35777732-35777754 CCTCACCCTCACCTCTTCCCAGG - Exonic
1165754600 19:38285248-38285270 TCTCATCACCACCAGCTCTCAGG - Intronic
1166200401 19:41233841-41233863 CCACATCACCAAGTGTCCCCAGG + Intronic
1167350152 19:48969305-48969327 CCTCAGCCCCACCAGCTCCCTGG - Exonic
1168105027 19:54161233-54161255 CCTCTTCTCCACCTGCTCCCCGG - Exonic
1168336892 19:55602177-55602199 CCTTATCTCCTCCTGTTCCCCGG + Exonic
1168354071 19:55691438-55691460 CCTTAACTCCACCTGCTCCCAGG - Intronic
925055838 2:856777-856799 CCTCACCACCACCTCGTCCTTGG + Intergenic
925090091 2:1148369-1148391 CGACATCACCTCGTGTTCCCAGG + Intronic
927471218 2:23379083-23379105 CCTTGTCACCCTCTGTTCCCTGG + Intergenic
927540299 2:23903985-23904007 TCCCGTCATCACCTGTTCCCTGG - Intronic
927687846 2:25184394-25184416 CGTCACCATCACCTGCTCCCTGG - Intergenic
927906522 2:26862629-26862651 CCCCATCCCTACCTGCTCCCTGG + Intronic
929450796 2:42035734-42035756 CCACATCAACACCTGCTCCCTGG + Intergenic
931156027 2:59631170-59631192 CCACTTCAATACCTGTTCCCTGG + Intergenic
932141354 2:69281003-69281025 CCCCACCACCACCTGTTCCCAGG + Intergenic
932615547 2:73228961-73228983 TCTTATCACCACCTCTTCCAGGG - Exonic
933354033 2:81193110-81193132 ACTCACCACCACATTTTCCCTGG + Intergenic
935189685 2:100766878-100766900 CCTCATCACAACCTACTCCCTGG + Intergenic
936153759 2:110035515-110035537 CCTCCCCACCTCCTGCTCCCTGG + Intergenic
936190926 2:110335900-110335922 CCTCCCCACCTCCTGCTCCCTGG - Intergenic
937588235 2:123582599-123582621 CTCCATCTCCACCTGCTCCCTGG + Intergenic
937960849 2:127457149-127457171 CTTCACCACCACCTGTTCTCAGG - Intronic
941526248 2:166610323-166610345 CCTTATCACCTCCTCTTCCCTGG + Intergenic
943326560 2:186505820-186505842 CCTCATCACCACCTGTTCCCTGG - Exonic
948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG + Intronic
1171278781 20:23879791-23879813 CCCCAACCCCACCTGCTCCCTGG + Intergenic
1174130995 20:48343212-48343234 CCTCGTGTCCACCTGGTCCCTGG - Intergenic
1175596344 20:60237717-60237739 CCCTATCTCCACCAGTTCCCGGG + Intergenic
1175714657 20:61247358-61247380 CGTCCTCTGCACCTGTTCCCTGG - Intergenic
1175739125 20:61408308-61408330 CCGCATCACCATCTGTTCCTGGG - Intronic
1175898504 20:62350804-62350826 CCTCAGGAGCACCTGTTCCGGGG - Intronic
1178664377 21:34533870-34533892 CCTCCACACCTGCTGTTCCCTGG - Intronic
1179765876 21:43572598-43572620 CCTCCTCTCCAGCTGCTCCCTGG + Intronic
1180959026 22:19754398-19754420 CCCCAGCACCATCTGCTCCCTGG - Intergenic
1181023837 22:20116789-20116811 CCTCGTCCCCACCTATTCTCTGG + Intronic
1181271410 22:21660974-21660996 CCTCATCACCCCCTGGCACCTGG + Intronic
1183633311 22:39046294-39046316 CCTCATCCCCACCTCCTCACAGG - Intronic
1184420695 22:44381331-44381353 CCTCCTCAGCTCCTGTTGCCAGG - Intergenic
1184534622 22:45077992-45078014 CCTCGGCACCACCTGCTCCCAGG - Intergenic
1184859687 22:47166117-47166139 ACTCGTCAACACCTGCTCCCGGG - Intronic
1185376825 22:50486538-50486560 CCTCTGCACCACCCCTTCCCCGG - Intergenic
949158899 3:857924-857946 CCGCAGCACCAACTCTTCCCTGG + Intergenic
949159112 3:859340-859362 CCGCAGCACCAGCTCTTCCCCGG + Intergenic
950105902 3:10388298-10388320 CCTCTTCACCACCAGCCCCCAGG + Exonic
950435404 3:12976352-12976374 CCTTTTCCCCACCTCTTCCCCGG + Intronic
951863863 3:27285114-27285136 CCTCACCTCCACCTCTTCCAGGG - Intronic
952446478 3:33385618-33385640 CCTCATCACCCCTTGGGCCCAGG - Exonic
953223588 3:40997246-40997268 CCTCATCACCTCATGGTCACAGG - Intergenic
953856140 3:46500439-46500461 CCTCATCTTCACCTGGCCCCTGG - Exonic
954218003 3:49135051-49135073 CCTAATCAACACTTGATCCCTGG + Intergenic
955391461 3:58525384-58525406 CCTCATCCTCACCTATTCTCAGG - Intronic
957791660 3:84949672-84949694 CCACATCACCACTGGTTCTCAGG - Intergenic
961088939 3:124093236-124093258 CCTCAGCACCAGCTCTTCCTTGG - Intronic
961483892 3:127203992-127204014 TATAATCACCACCTGTTCCTGGG + Intergenic
961651793 3:128420619-128420641 CCTCATCAGCTCCTTTTCCTGGG + Intergenic
963720384 3:148855155-148855177 CCTCATCACCACGTCTTCGATGG - Intronic
970275019 4:14389984-14390006 CCTTCTCACTATCTGTTCCCAGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
975556813 4:75673352-75673374 CCTCACAACCACCTCTTCCCGGG + Exonic
980932401 4:139194419-139194441 CCAAATGAACACCTGTTCCCTGG + Intergenic
981884199 4:149653184-149653206 ACTCTTGACCACCTGCTCCCTGG - Intergenic
984709792 4:182875611-182875633 CCCTATCACCGCCTGTTCTCTGG + Intergenic
984835910 4:184020830-184020852 TCTGAACACCAGCTGTTCCCAGG + Exonic
985111151 4:186547150-186547172 CCTCCTCACACCCTGTTCCTGGG + Intronic
985111211 4:186547435-186547457 CCTCCTCACACCCTGTTCCTGGG + Intronic
985927020 5:3026769-3026791 CATGGTCACCACCTGTGCCCTGG - Intergenic
986735362 5:10663789-10663811 CCTCCTCACCCCTTGTGCCCAGG + Intergenic
987040663 5:14059229-14059251 CTTCAGCACCAGCTGTGCCCTGG + Intergenic
990048601 5:51466891-51466913 CCTCCTGACCACCTGTTCCCAGG + Intergenic
990507153 5:56456090-56456112 CCTCATCCCCACCCCTGCCCAGG + Intergenic
992104050 5:73436111-73436133 CCACCTCCCCACCTGTTGCCCGG - Intergenic
992389285 5:76315489-76315511 ACTCAGCACCACCTCTTCTCAGG - Intronic
994569498 5:101497105-101497127 CCTCCTCCCTACCTGTTCCTAGG - Intergenic
997145009 5:131423063-131423085 CCTCTTCACCAGGTTTTCCCAGG - Intergenic
997210527 5:132074365-132074387 CCACTTTACCACCTGTCCCCTGG - Intronic
997295197 5:132764559-132764581 CCTCATCACCCCCATTCCCCAGG + Intronic
997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG + Intronic
998682189 5:144481042-144481064 CCTCATCACTACCAGATCCCTGG - Exonic
999259815 5:150231052-150231074 CCTCCTCACATCTTGTTCCCTGG - Intronic
999308894 5:150538752-150538774 CCTTGTCACCACCTCATCCCTGG - Intronic
999470480 5:151850404-151850426 CCTGAACACTTCCTGTTCCCAGG - Intronic
999776361 5:154815640-154815662 CCTCCTCATCCCTTGTTCCCAGG - Exonic
1001530928 5:172461158-172461180 CCTCATAACATCCTGCTCCCTGG + Intergenic
1001794515 5:174490949-174490971 CCTCATTCCCACCTGTTGCCTGG - Intergenic
1002542586 5:179915840-179915862 CCTCTCCTCCACCTGTGCCCTGG + Intronic
1003693659 6:8380023-8380045 CCTCATCACTCACTGTCCCCTGG - Intergenic
1005056959 6:21738432-21738454 CCTCATCTCCAGTTGTCCCCTGG - Intergenic
1005600125 6:27418199-27418221 CCTCATGACTACCTTTTCCCTGG - Intergenic
1006990241 6:38209134-38209156 CCTCATCTCCAGCTGTTGTCAGG - Intronic
1007930841 6:45689245-45689267 CCTCATCCCCACCAGTAGCCAGG + Intergenic
1013428493 6:110035624-110035646 CTTGGTTACCACCTGTTCCCTGG + Intergenic
1014089553 6:117388132-117388154 CCTCATCAACAAATGATCCCTGG - Intronic
1016933579 6:149432016-149432038 CCTCATCCTCAGCTGTTCACTGG + Intergenic
1017146390 6:151239717-151239739 CCTCATTTCCCCCCGTTCCCCGG + Intergenic
1019727444 7:2610966-2610988 CCTCCTCTCCTCCTCTTCCCCGG - Exonic
1020720570 7:11739719-11739741 CCTCATCATCATCTCTTGCCTGG + Intronic
1020765057 7:12308961-12308983 CCTCATCTCCTCCTTTTCTCAGG - Intergenic
1021397899 7:20172923-20172945 CCACAGCACCACCTGGTGCCAGG + Intronic
1023253966 7:38294489-38294511 CCTCATCATCCCCTTTTCCAAGG - Intergenic
1024005957 7:45224967-45224989 TCTCCTCACTACCTGTCCCCTGG + Intergenic
1024047568 7:45595621-45595643 CCTCATCCCCACGTTTCCCCAGG + Intronic
1025149751 7:56539186-56539208 CCTCACCAGCACCTTTTCCGTGG + Intergenic
1027166947 7:75841436-75841458 CTGCAACACCACCTCTTCCCTGG - Intergenic
1027219887 7:76207004-76207026 CCTCCCCACCACCATTTCCCAGG + Intronic
1027475797 7:78630072-78630094 CCTCATCACCACCCAGCCCCTGG + Intronic
1029546161 7:101211716-101211738 CCTCACCCCCACCTGTCCGCAGG - Exonic
1029661436 7:101964888-101964910 TCTCATCTCCACCTGATCCCAGG + Intronic
1031663781 7:124459973-124459995 TCTCACCACCACCAGTGCCCTGG + Intergenic
1033234800 7:139629784-139629806 CCACATGTCCAGCTGTTCCCAGG - Intronic
1035710074 8:1706365-1706387 CACTTTCACCACCTGTTCCCAGG - Exonic
1036936141 8:13004286-13004308 CCTCCTCCCCACCTGGTCCACGG - Intronic
1039335972 8:36589871-36589893 CCTGATCACCCCCTGTTGTCCGG + Intergenic
1039773922 8:40716923-40716945 CCTTTTCTCCTCCTGTTCCCTGG + Intronic
1040579879 8:48689162-48689184 CCTGGCCCCCACCTGTTCCCAGG + Intergenic
1040813846 8:51485529-51485551 CCTCATCCCCATCATTTCCCAGG + Intronic
1040853023 8:51921581-51921603 CCTCATCCCCACCAGCTGCCAGG - Intergenic
1040893691 8:52343177-52343199 CCTCACCCCCACCTCTGCCCTGG - Intronic
1041255968 8:55979938-55979960 CCACATCAAGACCTGTTCCTTGG + Intronic
1042483101 8:69325156-69325178 CCGCAGCACCAACTCTTCCCCGG - Intergenic
1042483235 8:69326015-69326037 CCACAGCACCAACTCTTCCCTGG - Intergenic
1043919586 8:85965797-85965819 TCTCATCTCCACCGTTTCCCAGG - Intergenic
1045038707 8:98199838-98199860 CCTCATCAACACATTTTCCCAGG + Intronic
1047313463 8:123711460-123711482 CCTCATCCCACCCTGGTCCCTGG + Intronic
1048690482 8:136956715-136956737 CAACATGACCACCTTTTCCCTGG + Intergenic
1049001056 8:139825942-139825964 CCTCATCATGGCCTGTTCCACGG - Intronic
1049037277 8:140086477-140086499 CCACAGCTCCACCTGTGCCCTGG + Intronic
1049264565 8:141660525-141660547 CCTGAGCACCACTTCTTCCCAGG - Intergenic
1049354325 8:142180083-142180105 TCTCATCTCCACCAGCTCCCCGG - Intergenic
1049403569 8:142441723-142441745 TCTCATCACCATCTGAGCCCTGG - Intergenic
1049509747 8:143021591-143021613 CCTGAGCAAGACCTGTTCCCCGG + Exonic
1049756090 8:144311894-144311916 CCTCATCCCCAACTCTGCCCTGG - Intronic
1052593134 9:30524392-30524414 CAGCATCACCTCCTGTGCCCTGG - Intergenic
1052989424 9:34510486-34510508 CCTCCCTACCACCTGGTCCCTGG + Intronic
1053129990 9:35609343-35609365 CTTCATCAGCACCTGTTCCTCGG + Exonic
1054850436 9:69841995-69842017 CCCCATCACCCCCTATTCCCAGG + Intronic
1056992923 9:91427307-91427329 CGTCTCCACCCCCTGTTCCCAGG - Intergenic
1057200017 9:93134776-93134798 CCTCATAACCCCCATTTCCCAGG - Intergenic
1057465797 9:95313156-95313178 CCGCCCCAGCACCTGTTCCCAGG - Intronic
1057479326 9:95432255-95432277 GCCCATCACCACCTGTTCTGAGG - Intergenic
1059408750 9:114118762-114118784 CCTCACCAGCCCCTCTTCCCAGG - Intergenic
1062602668 9:137325362-137325384 CCTCCTCCGCACCTGTTCCCTGG - Intronic
1189100735 X:38186743-38186765 CTTCCTCCCCACCTGTTTCCTGG + Intronic
1192183297 X:68929627-68929649 CTTCCTCACCACCTCTTCCCTGG + Intergenic
1195484842 X:105392274-105392296 CCTCATCAGCACCAGTTCATAGG + Intronic
1198529661 X:137538999-137539021 CCTCCCCACCTCCTCTTCCCAGG - Intergenic
1200136923 X:153879739-153879761 CCCGACCCCCACCTGTTCCCTGG - Intronic