ID: 943329845

View in Genome Browser
Species Human (GRCh38)
Location 2:186545955-186545977
Sequence CAGCTCTACCACTTTCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943329845_943329849 15 Left 943329845 2:186545955-186545977 CCAACTAGAAAGTGGTAGAGCTG No data
Right 943329849 2:186545993-186546015 AGCTGATGTCTGTAAGCACTGGG No data
943329845_943329848 14 Left 943329845 2:186545955-186545977 CCAACTAGAAAGTGGTAGAGCTG No data
Right 943329848 2:186545992-186546014 AAGCTGATGTCTGTAAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943329845 Original CRISPR CAGCTCTACCACTTTCTAGT TGG (reversed) Intergenic
No off target data available for this crispr