ID: 943329848

View in Genome Browser
Species Human (GRCh38)
Location 2:186545992-186546014
Sequence AAGCTGATGTCTGTAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943329845_943329848 14 Left 943329845 2:186545955-186545977 CCAACTAGAAAGTGGTAGAGCTG No data
Right 943329848 2:186545992-186546014 AAGCTGATGTCTGTAAGCACTGG No data
943329844_943329848 15 Left 943329844 2:186545954-186545976 CCCAACTAGAAAGTGGTAGAGCT No data
Right 943329848 2:186545992-186546014 AAGCTGATGTCTGTAAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943329848 Original CRISPR AAGCTGATGTCTGTAAGCAC TGG Intergenic
No off target data available for this crispr