ID: 943337762

View in Genome Browser
Species Human (GRCh38)
Location 2:186639577-186639599
Sequence CACTTCCCAATAGTGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943337762_943337775 30 Left 943337762 2:186639577-186639599 CCTCCTTCCACTATTGGGAAGTG No data
Right 943337775 2:186639630-186639652 CTTTTAGATGAGGACAAACCTGG No data
943337762_943337772 -1 Left 943337762 2:186639577-186639599 CCTCCTTCCACTATTGGGAAGTG No data
Right 943337772 2:186639599-186639621 GGGGGTGGCTAGAGAGGAGTGGG No data
943337762_943337771 -2 Left 943337762 2:186639577-186639599 CCTCCTTCCACTATTGGGAAGTG No data
Right 943337771 2:186639598-186639620 TGGGGGTGGCTAGAGAGGAGTGG No data
943337762_943337774 20 Left 943337762 2:186639577-186639599 CCTCCTTCCACTATTGGGAAGTG No data
Right 943337774 2:186639620-186639642 GGAAGCGTGGCTTTTAGATGAGG No data
943337762_943337773 7 Left 943337762 2:186639577-186639599 CCTCCTTCCACTATTGGGAAGTG No data
Right 943337773 2:186639607-186639629 CTAGAGAGGAGTGGGAAGCGTGG No data
943337762_943337770 -7 Left 943337762 2:186639577-186639599 CCTCCTTCCACTATTGGGAAGTG No data
Right 943337770 2:186639593-186639615 GGAAGTGGGGGTGGCTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943337762 Original CRISPR CACTTCCCAATAGTGGAAGG AGG (reversed) Intronic
No off target data available for this crispr