ID: 943337918

View in Genome Browser
Species Human (GRCh38)
Location 2:186641677-186641699
Sequence AGCAAATCTCCTTCCTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943337914_943337918 21 Left 943337914 2:186641633-186641655 CCACCTGGAAAAGTTCTGTAAGT 0: 1
1: 1
2: 0
3: 18
4: 139
Right 943337918 2:186641677-186641699 AGCAAATCTCCTTCCTGGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 223
943337915_943337918 18 Left 943337915 2:186641636-186641658 CCTGGAAAAGTTCTGTAAGTCCA 0: 1
1: 0
2: 1
3: 6
4: 149
Right 943337918 2:186641677-186641699 AGCAAATCTCCTTCCTGGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 223
943337916_943337918 -2 Left 943337916 2:186641656-186641678 CCATCTGTAGAAGTCTACACGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 943337918 2:186641677-186641699 AGCAAATCTCCTTCCTGGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943337918 Original CRISPR AGCAAATCTCCTTCCTGGAA AGG Intronic
900030064 1:364798-364820 AGCGCATCTCCCTCCAGGAAGGG + Intergenic
900050716 1:593862-593884 AGCGCATCTCCCTCCAGGAAGGG + Intergenic
901039511 1:6355548-6355570 GTCACACCTCCTTCCTGGAATGG - Intronic
902153305 1:14462342-14462364 AGAAAATCTGCTTCCTGCACAGG - Intergenic
903002049 1:20273551-20273573 AGAAAATCTGATTTCTGGAAGGG - Intergenic
903442448 1:23398477-23398499 AGCAAAGCTCCTTCCCTTAAGGG + Intronic
904052974 1:27651414-27651436 ACCAAATATCCTTCCTGTAGCGG - Intergenic
906156040 1:43614514-43614536 AACAAATCCCCTTCCTAGATGGG - Intronic
908611424 1:65865369-65865391 AGCAATTCACTTCCCTGGAAAGG - Intronic
910096857 1:83532824-83532846 AGCAATTGTCCATCCAGGAAGGG + Intergenic
911922456 1:103782955-103782977 AGCAAATCTCTTTGCTGCAGTGG - Intergenic
912159942 1:106969831-106969853 AAGAAATCTTCATCCTGGAAGGG + Intergenic
915703023 1:157814183-157814205 AGAAAATCTCATTACTGTAACGG + Intronic
917373927 1:174327540-174327562 AGAAAACCTCCTACCTGGAAAGG + Intronic
921355536 1:214281330-214281352 AGCAAGTCCCCCACCTGGAAGGG - Exonic
922878950 1:228964696-228964718 AATAAATCTCATTCCTGGAAGGG + Intergenic
923344943 1:233042544-233042566 ATCCAATCTCCTCCCTGGGAGGG + Intronic
923454438 1:234151080-234151102 AGCAGAGCTCCCTCCTGGGATGG + Intronic
924753163 1:246916141-246916163 AGCAGTTGTTCTTCCTGGAAGGG - Exonic
1063962485 10:11318502-11318524 AGCTAATCTGCTTTCTGGAAGGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066053478 10:31659358-31659380 ATCAACTCTCCTCCCAGGAAGGG + Intergenic
1067424719 10:46197975-46197997 AGCAAATTTGTTTCCTGGTAAGG + Intergenic
1068031123 10:51706474-51706496 ACCAAATGTTCTCCCTGGAAGGG + Intronic
1068343463 10:55739497-55739519 AGCAATTCTTTTTCCGGGAAAGG - Intergenic
1068794080 10:61058647-61058669 AGAAAATCTTCATCCAGGAAGGG + Intergenic
1068941924 10:62689031-62689053 AGCAAATATCCATGCTGGACTGG + Intergenic
1069568335 10:69478564-69478586 AGCAAATATCATTCCTGCCATGG - Intronic
1070337505 10:75468448-75468470 GGCAAATCTTCCTTCTGGAAGGG - Intronic
1070774991 10:79104219-79104241 ACCAAATCTCCGTCATCGAAAGG - Intronic
1071931475 10:90476137-90476159 AGCAGAACTGCTGCCTGGAAGGG + Intergenic
1072061599 10:91817276-91817298 GGCAAATTTCCTACCTGGCAAGG - Intronic
1075340523 10:121643992-121644014 ATCACATCTCAATCCTGGAAAGG + Intergenic
1075665008 10:124223773-124223795 GCTAAATCTCCTGCCTGGAATGG + Intergenic
1075987434 10:126799866-126799888 AGCAAATCTGCTTTCTGGTGAGG + Intergenic
1076931947 10:133537296-133537318 AGCTAATCGCCTTCCTGCCAGGG + Intronic
1077629426 11:3800840-3800862 GGCAAATTTCCTGCCGGGAATGG + Intronic
1078084786 11:8227293-8227315 AGCACATCCCCTTCCAGGGAGGG + Intronic
1079884746 11:25973131-25973153 AACAAATCTCCTTCCTGCCTGGG + Intergenic
1080219250 11:29881243-29881265 AACAAATCTCCTTCCTGTTCAGG + Intergenic
1080818641 11:35783731-35783753 AGCCTAGCCCCTTCCTGGAAGGG + Intronic
1080830836 11:35891859-35891881 TTCAAATCTCTTTCCAGGAAGGG + Intergenic
1083107795 11:60375367-60375389 AGAAAATCTCCTTACTGAAAAGG - Intronic
1084044842 11:66562587-66562609 AGCAAATCTGCTTCCTGCTGTGG + Intronic
1084301284 11:68254266-68254288 AGCAAATCCCCGTCTTGGGACGG + Intergenic
1084792174 11:71481914-71481936 AGCAAAAACCCTGCCTGGAATGG - Exonic
1087363268 11:97187457-97187479 AGCATTTCTCCCTCCAGGAATGG + Intergenic
1087885407 11:103475862-103475884 AGAAAATCTCCTGACTAGAAAGG + Intronic
1095428418 12:42105523-42105545 ATAACATCTGCTTCCTGGAATGG + Intronic
1096003061 12:48145319-48145341 AGTACATCTGCTTCCTGGAGTGG + Intronic
1097123272 12:56752551-56752573 AGAAGATCCTCTTCCTGGAATGG - Exonic
1097147763 12:56953492-56953514 AGCAAATCCCTTTTCTGGAGGGG + Intronic
1101972066 12:109321860-109321882 TGCAAAACTCTTTTCTGGAATGG - Intergenic
1102018779 12:109666834-109666856 AGCAAAGGACCTTCCTGGACGGG - Intergenic
1102073236 12:110039191-110039213 AGCAAAGATACTTCTTGGAATGG + Exonic
1103308613 12:119987603-119987625 AGAACATTTCCTTGCTGGAATGG + Intergenic
1107177495 13:37416084-37416106 AGCAAAAAGCCTTCCTGGAAAGG - Intergenic
1108847783 13:54697070-54697092 ATCCCATCGCCTTCCTGGAAAGG - Intergenic
1108966138 13:56304476-56304498 AGGAAGTCTCCATCCTGTAAAGG + Intergenic
1110901477 13:80830917-80830939 AGGAAATCTGCTGCCTTGAAGGG + Intergenic
1113349200 13:109512051-109512073 ACCAATTCTCTTGCCTGGAAGGG + Intergenic
1113602856 13:111582991-111583013 AGCAAATGGCTCTCCTGGAAAGG + Intergenic
1114222931 14:20713230-20713252 AGCAAATCTCACTCCAGCAAAGG + Intergenic
1116087072 14:40254045-40254067 AGGAAATCTGCTGCCTTGAAAGG - Intergenic
1117573622 14:57074710-57074732 TGCAAATGTCCTTCCTTAAAGGG + Intergenic
1118064119 14:62172068-62172090 AGCAAGAGTCCTTCCTGGGATGG - Intergenic
1118471723 14:66080697-66080719 ACCAACTCTCCCTCCTAGAATGG + Intergenic
1118991232 14:70798951-70798973 AGAAAAACTCCTTCTTGTAAGGG - Intronic
1119128561 14:72150988-72151010 AGCATATTTTCTTCATGGAATGG + Intronic
1120005416 14:79351204-79351226 TGCAAATATCCTCTCTGGAAGGG - Intronic
1120176427 14:81298212-81298234 CTCATTTCTCCTTCCTGGAAGGG - Intronic
1120708290 14:87767505-87767527 ATCTAATCTCCTGGCTGGAAGGG - Intergenic
1121883859 14:97524911-97524933 AGCAAATCTAGTTCTTGGAAAGG - Intergenic
1124936271 15:34174755-34174777 AGCGATTCTCCTGCCTGGATGGG + Intronic
1125333309 15:38603338-38603360 AGCAAATCTGCTTCCCGCATGGG - Intergenic
1131476187 15:92742226-92742248 AGCAATTCTCCTTCTTTGGAAGG - Intronic
1135149499 16:19993233-19993255 ACCAAATCTCTTTCCTGCAGTGG + Intergenic
1135651323 16:24209165-24209187 AGCAAATGTGCTTCCTAGACTGG + Intronic
1135936030 16:26780805-26780827 AGAAACACTTCTTCCTGGAAAGG + Intergenic
1137580448 16:49630587-49630609 AGCAAATCGCCATCCTTGGAGGG - Intronic
1138825509 16:60314532-60314554 TTAAAATCTCCTTCCTTGAAGGG + Intergenic
1139657789 16:68399476-68399498 AGTACATCTGCTGCCTGGAATGG + Intronic
1143415963 17:6750497-6750519 ATCATATCACCTTCATGGAAAGG - Intergenic
1143675142 17:8426989-8427011 GGCAAAGCACCTTCCTGGCAAGG + Intronic
1145374065 17:22331391-22331413 GGCAAACCTCCTTCATAGAATGG - Intergenic
1147456852 17:40543212-40543234 ACCAAAGCTCCTCCCAGGAAGGG - Intergenic
1149823331 17:59801778-59801800 AGCAATTCTCCTGCCTGAACTGG - Intronic
1151850538 17:76687156-76687178 AGCAAGGGTCCTTCCTGGTAAGG + Intronic
1152949693 17:83221762-83221784 AGCGCATCTCCCTCCAGGAAGGG - Intergenic
1153945264 18:10012330-10012352 GGCCTATCTCCTTCCTGGAATGG + Intergenic
1154150085 18:11899764-11899786 AGAAAATCATCTTCCTAGAAAGG - Intronic
1155032730 18:21998374-21998396 AGCAATATTCCTTCCTTGAAGGG + Intergenic
1157076575 18:44473739-44473761 ATCAAATCTGCATGCTGGAAGGG - Intergenic
1158899389 18:61948783-61948805 AGCAAACCTCCTTCCCAGAGGGG + Intergenic
1159504740 18:69321190-69321212 AGAAAATCACCTTCCCTGAAAGG - Intergenic
1159896259 18:73999336-73999358 AGAAAATCACCTTCATGAAAAGG - Intergenic
1163724194 19:18913260-18913282 AGCAAGCCTCCTTCCTGGGGTGG - Intronic
1164148887 19:22532145-22532167 AGCAAATCTCACTCCAGGCAGGG + Intronic
1164155879 19:22596590-22596612 AGCAAATCTCACTCCAGGCAGGG - Intergenic
1164498406 19:28791733-28791755 AGCATATCACCTTTCAGGAAAGG - Intergenic
1164680153 19:30129127-30129149 AGCAAATTTTCTTTCTGGGATGG - Intergenic
1164804944 19:31109344-31109366 AGAAAGTCTCCTGCCTGGTAAGG - Intergenic
1165569384 19:36762626-36762648 AGCAAACCTCCTTCATAGAATGG + Exonic
1166437610 19:42782041-42782063 TGCAAATCTCATTCCTGTGAAGG - Intronic
1167471801 19:49679752-49679774 AGCAATTCTCCTTCTTGGTGGGG - Intronic
925698974 2:6613805-6613827 AGGGAATCTGCTACCTGGAAAGG - Intergenic
926064857 2:9830451-9830473 TGTTACTCTCCTTCCTGGAAGGG + Intergenic
926125796 2:10270865-10270887 AAGAAACCTCCTTCCTGGCAGGG - Intergenic
926834184 2:16999275-16999297 AGCAAACCTGCTGCCTTGAAGGG - Intergenic
927616735 2:24605575-24605597 AGCAATTCTACTTCTAGGAAGGG - Intronic
927790943 2:26009060-26009082 AGCATTTCTCCTTCCTGGCATGG + Intergenic
928854371 2:35786960-35786982 ACCAAATCACCTACCTGGGAAGG - Intergenic
929175138 2:38968336-38968358 AGCAAATCTCCACACTAGAAAGG - Intronic
929804114 2:45129611-45129633 AGCAAATCTCCTCTCAAGAATGG + Intergenic
929830083 2:45340064-45340086 AGCTCCTCTCCTTCCTGGTATGG - Intergenic
932897624 2:75657349-75657371 TTCCAATCTCCTTCCTGGAGGGG + Exonic
935750928 2:106233115-106233137 AGGAAACCTACTTCCTTGAAGGG + Intergenic
935846795 2:107174662-107174684 AGCAAATATTTTTCCTGGATGGG + Intergenic
936033781 2:109093134-109093156 AGCCAATTTCATTCCTGCAAAGG - Intergenic
936110373 2:109659811-109659833 AGCAAATCTCCAGTCTGGGAGGG + Intergenic
938869008 2:135454183-135454205 AACACATGTTCTTCCTGGAAGGG - Intronic
941119031 2:161507303-161507325 AGCAGTTGTTCTTCCTGGAAGGG - Intronic
943337918 2:186641677-186641699 AGCAAATCTCCTTCCTGGAAAGG + Intronic
946947344 2:224834608-224834630 AGCAATTCTTCATCCTGAAAGGG + Intronic
948754721 2:240152348-240152370 AGCAAGTCTCCTTCCGGCGAAGG + Intergenic
1169339086 20:4782530-4782552 AGCAAGTCTCCTTCCTCCATAGG - Exonic
1169543735 20:6629703-6629725 AGGACTTCTCCTTCCTGTAATGG + Intergenic
1169832478 20:9839258-9839280 AGCAAAACTCAATCCTGCAATGG - Intergenic
1172030361 20:31977699-31977721 AACAACTCTCCTTCCTCGATAGG - Intronic
1176728323 21:10463422-10463444 AGAAAGTGTCCTTCCTGGAATGG - Intergenic
1177589348 21:23142732-23142754 AGCAAACCTCCTTCCTGCCTGGG + Intergenic
1179128504 21:38613800-38613822 AGGAAATCTCCCACCTAGAAGGG + Intronic
1179267289 21:39814957-39814979 AGCAAATCCCATTCCTGGTGAGG - Intergenic
1182653930 22:31874482-31874504 TGCAGATCTCATTACTGGAAAGG - Intronic
1184105674 22:42366328-42366350 AGCAAGCCTCCTGCCTGGAATGG - Intergenic
1184292201 22:43503404-43503426 AGCCAATATGCTTCCTGGCAGGG - Intronic
1184437422 22:44487906-44487928 GGCATCTCTCCTTCCTGGACTGG + Intergenic
1185011635 22:48317844-48317866 AGCCAACCTCCTGCCTGGCAAGG + Intergenic
1185381827 22:50512376-50512398 GGTAAATCTCCTTCCTGGCTTGG + Intronic
950347668 3:12312894-12312916 AGCAATTCTTCCTCCTAGAATGG - Intronic
950706252 3:14784336-14784358 ACCCAATCTCCTTCCTGGAAGGG - Intergenic
951772922 3:26278789-26278811 TGTAAATTTCCTTACTGGAAAGG + Intergenic
952032815 3:29164790-29164812 ATCAAAGCTTCTTCCTGAAAGGG + Intergenic
953742149 3:45547265-45547287 ACCAAACCTCCTGCCTGTAAAGG - Intronic
954237168 3:49265687-49265709 GGCCAATCTCCCTCCTGAAATGG - Intergenic
955021353 3:55124710-55124732 AGCACAACTCCTTCCTTTAAGGG - Intergenic
955298934 3:57758307-57758329 AGCAATTATCCTTACTAGAAAGG - Intronic
956228878 3:66990328-66990350 AGCTTTTCTCCTTCCGGGAATGG + Intergenic
957798857 3:85048753-85048775 AGCAAATCACCTACCTCAAATGG - Intronic
959164474 3:102759242-102759264 AGCAATGCACCTTCTTGGAAGGG + Intergenic
962193230 3:133333044-133333066 AGCACCTCTCCTTCCTTGTAGGG + Intronic
962585491 3:136839220-136839242 AGAAAGGCTCTTTCCTGGAAAGG + Intronic
965060031 3:163773426-163773448 AGGAAACCTACTTCCTTGAAGGG - Intergenic
965109939 3:164407930-164407952 AATCAATATCCTTCCTGGAAAGG - Intergenic
967209807 3:187158368-187158390 AGCAAATCTGGTGTCTGGAAAGG + Intronic
967853891 3:194102016-194102038 AGCAAAATCACTTCCTGGAATGG - Intergenic
969043828 4:4322149-4322171 GGCACATCTCCTTCCTGCAGAGG - Intergenic
969701868 4:8772063-8772085 AGCAGATATCCTTCCTGCACAGG + Intergenic
970324743 4:14911724-14911746 AACAAATCTCCTTTCTTGGAGGG - Intergenic
973655114 4:53039072-53039094 AGCCAAACTGCTACCTGGAAAGG - Intronic
974343219 4:60640962-60640984 AGCAGATCTCCTTCCTTTACAGG + Intergenic
974769900 4:66399234-66399256 AGAAAATCTCCTTCACTGAAAGG - Intergenic
975108940 4:70601583-70601605 GGCAGTTCTCCTTCCTGCAAGGG - Exonic
977307431 4:95342415-95342437 AGCAAAACTACTACCTTGAAGGG + Intronic
981204616 4:142025135-142025157 AGCAATTTTAATTCCTGGAAAGG - Exonic
984503035 4:180580401-180580423 AGCAAATTTCCTTTCCAGAAAGG + Intergenic
987668247 5:20973688-20973710 AGAATATCTCTTTTCTGGAATGG - Intergenic
988349437 5:30083392-30083414 ATACAATCCCCTTCCTGGAAAGG - Intergenic
989319231 5:40115789-40115811 ATTAAATCTCCTTCATTGAATGG + Intergenic
993877064 5:93319612-93319634 AGGAAGTTTCCTTACTGGAATGG - Intergenic
994132860 5:96250445-96250467 ATCATTTCTCCTGCCTGGAATGG - Intergenic
995904223 5:117104180-117104202 AGAGAAACTCCTTCCTTGAAGGG + Intergenic
1000560723 5:162785543-162785565 GGCATATCACCTTCCTGTAATGG - Intergenic
1001588853 5:172851932-172851954 GGCAAATCTCCTACTTGGGATGG - Intronic
1002743925 5:181455574-181455596 AGCGCATCTCCCTCCAGGAAGGG - Intergenic
1004298828 6:14438513-14438535 AGCCACTGTCCTTCCTGGAGTGG - Intergenic
1005082204 6:21967504-21967526 TGCGAATCTCCTTCCAGAAAAGG - Intergenic
1005100066 6:22162171-22162193 AGCTATTCTCATTACTGGAATGG + Intergenic
1005475686 6:26205395-26205417 AACCAATCATCTTCCTGGAAAGG + Intergenic
1007590591 6:43018438-43018460 AGTAAATCTCATTGTTGGAATGG - Exonic
1007955225 6:45911960-45911982 AGCAACTCTGCTTCCAGGGATGG + Intronic
1008023801 6:46610785-46610807 GGCATATCACCTTCCTGGATGGG - Intronic
1008681876 6:53880809-53880831 TGCAACTGTCATTCCTGGAATGG + Intronic
1010362613 6:75012449-75012471 AGCAAATCTGATGCCTGGTAAGG + Intergenic
1010832147 6:80543835-80543857 GGCAACTCTGCTTCCTGGGATGG + Intergenic
1010975165 6:82303872-82303894 AGGAAATGGCCTTCCTGAAAAGG - Intergenic
1011007411 6:82662131-82662153 AGCAAAATACCTTCCTAGAAAGG + Intergenic
1011997091 6:93604948-93604970 AGCAAATCTCTAGCCTGGACAGG + Intergenic
1013134901 6:107272653-107272675 TGCCAATCTGCTTTCTGGAAAGG - Intronic
1013192167 6:107812672-107812694 AGAAAATGTCCCTGCTGGAAGGG - Intronic
1014138573 6:117916018-117916040 AGCAGATCTCTTTCCTGTAGTGG - Intronic
1017488478 6:154923791-154923813 AGAAAATCTCTTCCATGGAAAGG - Intronic
1018714845 6:166524204-166524226 AGCTTATTTCCTTCCAGGAAGGG + Intronic
1019248784 6:170728803-170728825 AGCGCATCTCCCTCCAGGAAGGG - Intergenic
1020603851 7:10310167-10310189 AAAAAATCTCCTTCATTGAAGGG - Intergenic
1022858522 7:34340992-34341014 TGCAAATCTGTTACCTGGAAGGG - Intergenic
1028307943 7:89290117-89290139 AGGAAATCTGCTGCCTTGAAAGG + Intronic
1028881850 7:95888976-95888998 AGCATTTCTCATTCCTTGAAAGG - Intronic
1029415653 7:100441657-100441679 AGCAAGTCTCAGTGCTGGAAGGG + Intergenic
1030508794 7:110457317-110457339 AGCAAATTTCTTTCATGAAAAGG + Intergenic
1030872093 7:114768366-114768388 GGCAAATCTTCTGTCTGGAAAGG - Intergenic
1031016123 7:116578453-116578475 AGCATTTCTACTCCCTGGAATGG + Intergenic
1032374457 7:131396742-131396764 AACAGATCTCATTCCAGGAATGG - Intronic
1033424011 7:141226955-141226977 TGCAAAGCTCCATCCAGGAATGG - Intronic
1034066294 7:148140174-148140196 AGCACATTTCTTTCCTGGAACGG + Intronic
1034601774 7:152264548-152264570 AGAAATTGTCCTTCCTGGAATGG + Intronic
1035499261 8:78532-78554 AGCGCATCTCCCTCCAGGAAGGG + Intronic
1035556578 8:571692-571714 AACAGCTCTCCTTCCTGTAAAGG + Intergenic
1037586455 8:20280030-20280052 AGCAATTCTACTTCTTGGGATGG - Intronic
1041463010 8:58132311-58132333 AGCAAAACTCCTTCCTGCTACGG - Intronic
1042927505 8:73980918-73980940 AGCAGATTTCCTGCCTGGAGAGG + Intronic
1042954488 8:74234380-74234402 AGTAAATCTCCTTCCTACATGGG - Intergenic
1043910825 8:85861862-85861884 TTCAACTCTCCTTCCTGGATTGG + Intergenic
1044672961 8:94701483-94701505 ACCCAATCTCCTTCCCAGAAAGG - Intronic
1045280206 8:100743442-100743464 GGCAGACCTCCTTCCTGGATGGG - Intergenic
1048062787 8:130937672-130937694 TGCAAATGTCCTTGCTGGAAAGG - Intronic
1051166438 9:14267118-14267140 AGAAAATTTGTTTCCTGGAAGGG + Intronic
1051808714 9:21026343-21026365 ACGAAATCTCCTTCCAGGATAGG + Intronic
1053796716 9:41733256-41733278 AGCAAACCTCCTTCATAGAAAGG + Intergenic
1054148470 9:61581605-61581627 AGCAAAGCTCCTTCAAAGAAAGG - Intergenic
1054185129 9:61945331-61945353 AGCAAACCTCCTTCATAGAAAGG + Intergenic
1054468220 9:65512700-65512722 GGCAAACCTCCTTCATAGAAAGG - Intergenic
1054653380 9:67643165-67643187 AGCAAACCTCCTTCATAGAAAGG - Intergenic
1055025027 9:71710732-71710754 AGCAAGTCTCCGTACTGGACAGG + Intronic
1055680755 9:78712641-78712663 AGCAACTCTCTCTCCTGGCATGG - Intergenic
1058329834 9:103746214-103746236 AGAAAATTGCCTTCCTGGATGGG + Intergenic
1060082140 9:120659074-120659096 AATAAATCTGCTTTCTGGAAGGG - Intronic
1203609740 Un_KI270748v1:86067-86089 AGCGCATCTCCCTCCAGGAAGGG - Intergenic
1187278687 X:17839296-17839318 AGCAAGTCTCCTTACTGCGAAGG - Intronic
1187483747 X:19682512-19682534 AGCAAGTCCCCATCTTGGAAAGG - Intronic
1189631876 X:42962643-42962665 GGGAAAGCTCATTCCTGGAAAGG + Intergenic
1189725716 X:43966455-43966477 AAAAAATCCCCTTCCTGGGAGGG - Intronic
1190989298 X:55528821-55528843 AGCCACTATCCTTCCTAGAAGGG + Intergenic
1191696187 X:63993275-63993297 AGCAAATCAGATTTCTGGAATGG - Intergenic
1192505692 X:71680765-71680787 AGCAAATCTGCTGCCTTGAAGGG - Intergenic
1193667100 X:84334141-84334163 AGGAAATTTACTTCCTGTAATGG + Intronic
1194340686 X:92701187-92701209 AGAAAACCTGCTTCCTTGAAGGG - Intergenic
1196660504 X:118264196-118264218 AGCAAACCTGCTGCCTTGAAGGG + Intergenic
1196808622 X:119610587-119610609 AGCAAAGCCCCTCCCTGCAAAGG - Intergenic
1197072896 X:122321922-122321944 AGCAAACCTGCTGCCTTGAAGGG + Intergenic
1197363232 X:125532967-125532989 AGGAAACCTGCTGCCTGGAAGGG - Intergenic
1197621075 X:128749617-128749639 AACAAATCTCCTTCATGAAAAGG - Intergenic
1199321592 X:146446092-146446114 AGCAAACCCCCTTCCTGCATGGG + Intergenic
1199878075 X:151950812-151950834 AACAAGTCACCTTCCTGGCAGGG + Intergenic
1199945812 X:152666122-152666144 TGAATATCTCCTTCCTGGAGGGG - Intergenic