ID: 943341773

View in Genome Browser
Species Human (GRCh38)
Location 2:186691026-186691048
Sequence TTCACAAATCTTTTGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943341773_943341777 15 Left 943341773 2:186691026-186691048 CCCTACATCAAAAGATTTGTGAA No data
Right 943341777 2:186691064-186691086 TTATTCTAGGGTAAAATATGTGG No data
943341773_943341775 2 Left 943341773 2:186691026-186691048 CCCTACATCAAAAGATTTGTGAA No data
Right 943341775 2:186691051-186691073 AATATATATTTATTTATTCTAGG No data
943341773_943341776 3 Left 943341773 2:186691026-186691048 CCCTACATCAAAAGATTTGTGAA No data
Right 943341776 2:186691052-186691074 ATATATATTTATTTATTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943341773 Original CRISPR TTCACAAATCTTTTGATGTA GGG (reversed) Intergenic