ID: 943341774

View in Genome Browser
Species Human (GRCh38)
Location 2:186691027-186691049
Sequence GTTCACAAATCTTTTGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943341774_943341776 2 Left 943341774 2:186691027-186691049 CCTACATCAAAAGATTTGTGAAC No data
Right 943341776 2:186691052-186691074 ATATATATTTATTTATTCTAGGG No data
943341774_943341775 1 Left 943341774 2:186691027-186691049 CCTACATCAAAAGATTTGTGAAC No data
Right 943341775 2:186691051-186691073 AATATATATTTATTTATTCTAGG No data
943341774_943341777 14 Left 943341774 2:186691027-186691049 CCTACATCAAAAGATTTGTGAAC No data
Right 943341777 2:186691064-186691086 TTATTCTAGGGTAAAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943341774 Original CRISPR GTTCACAAATCTTTTGATGT AGG (reversed) Intergenic
No off target data available for this crispr