ID: 943341775 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:186691051-186691073 |
| Sequence | AATATATATTTATTTATTCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943341774_943341775 | 1 | Left | 943341774 | 2:186691027-186691049 | CCTACATCAAAAGATTTGTGAAC | No data | ||
| Right | 943341775 | 2:186691051-186691073 | AATATATATTTATTTATTCTAGG | No data | ||||
| 943341773_943341775 | 2 | Left | 943341773 | 2:186691026-186691048 | CCCTACATCAAAAGATTTGTGAA | No data | ||
| Right | 943341775 | 2:186691051-186691073 | AATATATATTTATTTATTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943341775 | Original CRISPR | AATATATATTTATTTATTCT AGG | Intergenic | ||