ID: 943341776

View in Genome Browser
Species Human (GRCh38)
Location 2:186691052-186691074
Sequence ATATATATTTATTTATTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943341774_943341776 2 Left 943341774 2:186691027-186691049 CCTACATCAAAAGATTTGTGAAC No data
Right 943341776 2:186691052-186691074 ATATATATTTATTTATTCTAGGG No data
943341773_943341776 3 Left 943341773 2:186691026-186691048 CCCTACATCAAAAGATTTGTGAA No data
Right 943341776 2:186691052-186691074 ATATATATTTATTTATTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943341776 Original CRISPR ATATATATTTATTTATTCTA GGG Intergenic
No off target data available for this crispr