ID: 943347336

View in Genome Browser
Species Human (GRCh38)
Location 2:186754933-186754955
Sequence CATTTTGAACAGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943347330_943347336 20 Left 943347330 2:186754890-186754912 CCAAAAGATTGGACACCCCTGTA 0: 12
1: 151
2: 630
3: 865
4: 788
Right 943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG No data
943347329_943347336 29 Left 943347329 2:186754881-186754903 CCAAGGCAGCCAAAAGATTGGAC No data
Right 943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG No data
943347331_943347336 5 Left 943347331 2:186754905-186754927 CCCCTGTACTAAATGAAAATTGG No data
Right 943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG No data
943347333_943347336 4 Left 943347333 2:186754906-186754928 CCCTGTACTAAATGAAAATTGGT No data
Right 943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG No data
943347328_943347336 30 Left 943347328 2:186754880-186754902 CCCAAGGCAGCCAAAAGATTGGA No data
Right 943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG No data
943347334_943347336 3 Left 943347334 2:186754907-186754929 CCTGTACTAAATGAAAATTGGTC No data
Right 943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943347336 Original CRISPR CATTTTGAACAGAAGGAAGA TGG Intronic
No off target data available for this crispr