ID: 943351353

View in Genome Browser
Species Human (GRCh38)
Location 2:186799958-186799980
Sequence CATGTTCACTTATAAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943351353_943351355 16 Left 943351353 2:186799958-186799980 CCTCTGACTTATAAGTGAACATG No data
Right 943351355 2:186799997-186800019 GTTTCTGCATTAGTTTTCTTAGG No data
943351353_943351356 23 Left 943351353 2:186799958-186799980 CCTCTGACTTATAAGTGAACATG No data
Right 943351356 2:186800004-186800026 CATTAGTTTTCTTAGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943351353 Original CRISPR CATGTTCACTTATAAGTCAG AGG (reversed) Intergenic
No off target data available for this crispr